Гдз биология лабораторные работы 8 класс: ГДЗ по биологии за 8 класс, решебник и ответы онлайн

Содержание

ГДЗ по биологии 8 класс Драгомилов, Маш Решебник

Рекомендуем посмотреть

  • Премиум

Есть дети, для которых интересней гаджетов и игр, животные и растения.

Они проводят время на природе чаще чем перед компьютером. Именно они в дальнейшем становятся великими учёными-зоологами, а в школе фанатеют от биологии. Но несмотря на кажущуюся простоту дисциплины с ней так же могут случиться трудности. И даже очень продвинутым школьникам иногда надо подставить крепкое плечо. Им может выступать методическое пособие. Восьмой класс — это время удивительных открытий и нового опыта. В жизни ребят происходит столько всего интересного что они часто забывают про свои школьные обязанности. Это в свою очередь, может плохо повлиять на их успеваемость. Благодаря «ГДЗ по биологии за 8 класс Драгомилов, Маш» учиться станет проще и веселее.

Трудности биологии в 8 классе

Данная дисциплина отличается от остальных своей исключительной важностью как раз в этот школьный год. Ребята узнают о таких серьезных вещах как:

  • железы внешней внутренней и смешанной секреции и эндокринная система;
  • первая помощь при травмах: растяжениях связок вывихах суставов переломах костей;
  • пищеварение в кишечнике, всасывание питательных веществ;
  • закономерности работы головного мозга а также врожденные и приобретенные формы поведения.

Таким образом восьмой класс запоминается детям полезными знаниями и новыми достижениями в школе и за её пределами.

ГДЗ по биологии за 8 класс Драгомилов, Маш – лучший помощник

Огромное количество информации усвоить нелегко, особенно, ребятам в восьмом классе. Наше пособие призвано облегчить насыщение новыми знаниями. Вот некоторые особенности:

  • современная система поиска необходимой страницы и номера упражнения;
  • электронный формат и расположение на сайте позволяют иметь круглосуточный доступ;
  • каждое из заданий было специально разобрано и объяснено;
  • все задания сопровождаются исключительно верными ответами.

Родители и онлайн-решебник

Трудно всегда быть готовыми к новым темам которые ваш ребенок проходит на школьных уроках. Это требует времени и определенного навыка быстро переваривать информацию.

Решебник даёт возможность быстро усваивать новые темы и всегда быть готовыми помочь своему чаду как освоить новый материал, так и сделать домашнее задание на отлично. Подростки уже так наловчились в списывании что это трудно искоренить. Но стоит им увидеть ожидаемый эффект в виде хороших отметок, и они сразу начнут действовать так:

  • сначала ребёнок должен внимательно прочитать параграф несколько раз;
  • затем приступить непосредственно к решению упражнений;
  • после этого можно сравнить, что получилось в тетради с тем, как правильно;
  • в конце рекомендуется исправить всё неточности и ещё раз прочитать материал для закрепления.

Подобный алгоритм несёт за собой не только повышение успеваемости но и улучшение собранности и самостоятельности. «ГДЗ по биологии за 8 класс авторы: Драгомилов А.Г., Маш Р.Д.» — это удобный инструмент с помощью которого можно не просто списать все правильные ответы, но и научиться работать самостоятельно.

Развить такие навыки как самопроверка и самоанализ. Стать круглым отличником и получать исключительно хорошие оценки. Наше пособие, как и многие другие решебники, всегда доступно на данном сайте. Для того чтобы увидеть в дневнике заветные пятёрки многие родители обкладывают своё чадо множеством однотипных учебников. Но после занятий с книгой от автора Сухоруковой и Кучменко можно отказаться от всех остальных методичек ведь она научит школьника выполнять домашку без посторонней помощи, быстро и качественно осуществлять подготовку к контрольным, уметь анализировать свои действия и нести за них ответственность и всегда быть готовым к уроку.

Быстрый поиск

Страницы

4 6 7 10 11 16 21 24 26 27 32 33 34 35 39 40 41 45 46 49 50 52 56 59 64 65 68 69 70 75 76 79 80 82 86 87 89 94 96 99 102 103 104 105 107 110 112 113 115 116 120 124 125–126 127 129 130 134 137 140 143 144 147 148 151 152 153 155 159 160 163 164 166 167 170 171 173 176 179 180 181 182 183 185 186 187 190 193 194 196 199 200 203 204 205 206 208 212 214 219 222 223 224 226 230 233 234 235 236 239 244 245 247 248 249 250 253 254 257 262 265 266 271 272 273

Наука, изучающая жизнь во всех ее проявлениях, называется биология. В общеобразовательных учреждениях дисциплина с одноименным названием вводится в учебное расписание в средних классах и изучается вплоть до выпуска. Она даёт знания о живых организмах, их строении, развитии, функциях жизнедеятельности и взаимоотношениях друг с другом. Несмотря на то, что предмет интересный его изучение очень часто вызывает сложности у школьников. Многие попросту не запоминают большое количество информации и это не лучшим образом отражается на успеваемости. Поможет в таком случае специальные средства в виде учебно-методического комлпекса.

Зачем школьникам нужно обзавестись решебником по биологии за 8 класс Драгомилов, Маш

На восьмом этапе обучения ребятам предстоит познакомиться с одним из биологических разделов под названием анатомия. В ходе его изучения они рассмотрят следующие темы:

  • человек и его место в природе;
  • строение скелета и мышц;
  • кровообращение, сердце и сосуды;
  • лёгкие и составляющие системы дыхания;
  • нервная деятельность и поведение.

Тематика обширная и чтобы ее в идеале усвоить ученикам 8 класса лучше всего обзавестись таким помощником как решебник с готовыми ответами.

Из чего состоят ГДЗ по биологии за 8 класс Авторы: Драгомилов А.Г., Маш Р.Д.

Сборник содержит в своем составе достоверные ответы к 59 параграфам рабочей тетради. Они детально расписаны и имеют подробнейшие пояснения абсолютно к каждому заданию. Пользоваться приложением достаточно легко. Его навигационная панель имеет табличный вид и отыскать нужную информацию ученик сможет без труда и особых затрат времени. Решебник полностью соответствует всем стандартам ФГОС и рекомендован к использованию специалистами. Имея под рукой онлайн-гдз восьмиклассник сможет:

  1. Как следует осуществить подготовку к различным проверкам знаний.
  2. Быстро и без ошибок сделать домашнюю работу.
  3. Проработать непонятную тему и закрепить ее.
  4. Запомнить важные термины и понятия.
  5. Дополнительно поработать дома и разобраться со сложным материалом.

В этом году у школьников не так много свободного времени. Поэтому часто они хотят просто списать ответы к заданиям не вникая во все тонкости дисциплины. Такой подход поможет сэкономить немного времени но приведет к образованию серьезных пробелов в знаниях. Решебник – это хорошая опора в обучении. Используя онлайн-ресурс регулярно школьник с лёгкостью усвоит учебный материал и всегда будет во всеоружии перед уроком. На страницах представлена почти вся программа за восьмой год обучения. В книге отражены такие темы как:

  1. Человеческий организм и его структура.
  2. Значение нервной, эндокринной и мочеполовой системы.
  3. Опорно-двигательный аппарат и его характеристика.
  4. Органы чувств и анализаторы.
  5. Биосоциальная природа человека.

Можно смело сказать, что онлайн-решебник соответствует всем требованиям федерального государственного образовательного стандарта. Решебник предлагает удобный сервис, с помощью которого ученики смогут получать наиболее хорошие оценки стать активными участниками занятий и порадовать своих родителей. Этот прекрасный задачник станет настоящей находкой для тех, кто хочет лучше познакомиться с устройством человека и мечтает стать врачом или биологом. Немаловажен и тот факт, что активное применение решебника в образовательном процессе поможет школьнику сократить среднее время работы с домашним заданием до минимального значения. Подросток сможет как следует отдохнуть и выспаться перед грядущим учебным днём. В итоге все будут получать только пятерки и четверки в дневники и тетрадки.

ГДЗ по биологии 8 класс Пасечник, Каменский Решебник

Вопросы к параграфу

1

1 2 3

2

1 2

3

1 2 3 4

4

1 2 3

5

1 2 3

6

1 2 3 4

7

1 2 3 4 5

8

1 2 3

9

1 2 3 4

10

1 2

11

1 2 3 4 5

12

1 2 3 4

13

1 2 3 4

14

1 2 3 4

15

1 2 3 4 5

16

1 2 3 4

17

1 2 3 4 5 6

18

1 2 3 4

19

1 2 3 4 5

20

1 2 3 4 5

21

1 2 3 4 5

22

1 2 3 4

23

1 2 3 4 5

24

1 2 3 4 5 6

25

1 2 3 4 5 6

26

1 2 3 4 5

27

1 2 3 4

28

1 2 3 4

29

1 2 3 4 5

30

1 2

31

1 2 3 4 5

32

1 2 3 4 5

33

1 2 3 4 5

34

1 2 3

35

1 2 3 4 5

36

1 2 3 4

37

1 2 3

38

1 2 3 4

39

1 2 3

40

1 2 3 4 5

41

1 2 3 4

42

1 2 3 4 5 6

43

1 2 3 4

44

1 2 3 4

45

1 2 3 4

46

1 2

47

1 2 3

48

1 2 3 4 5

49

1 2 3 4 5

50

1 2 3

51

1 2 3

52

1 2 3 4

53

1 2 3 4 5 6

54

1 2 3 4

55

1 2 3 4

56

1 2 3 4

57

1 2 3 4 5

58

1 2 3 4

59

1 2 3

Вспомните

1

1 2 3

2

1 2 3

3

1 2 3

4

1 2 3

5

1 2

6

1 2

7

1 2

8

1 2

9

1 2

10

1 2

11

1 2

12

1 2

13

1 2 3

14

1 2

15

1 2

16

1 2

17

1 2

18

1

19

1 2 3

20

1 2

21

1 2

22

1 2

23

1 2 3

24

1 2 3

25

1 2 3

26

1 2

27

1

28

1 2

29

1 2 3

30

1 2

31

1 2 3

32

1 2

33

1 2

34

1 2 3

35

1 2

36

1 2 3

37

1 2

38

1 2 3

39

1 2

40

1 2

41

1 2

42

1 2

43

1 2

44

1 2

45

1 2

46

1 2

47

1 2

48

1

49

1 2

50

1

51

1 2

52

1 2

53

1 2 3

54

1 2

55

1 2

56

1 2

57

1

58

1 2 3

59

1

Подумайте

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59

Дети начинают познавать мир вокруг с самого рождения, что позволяет им развиваться и получать все необходимые знания о природе и живых существах. С переходом в школу они продолжат изучения окружающего мира на соответствующих уроках, а с пятого класса приступят к освоению нового предмета – биологии. На занятиях они узнают о развитии жизни на Земле, а также о строении и ходе жизни растений и животных. К восьмому классу программа усложнится, поэтому для облегчения обучения школьники могут воспользоваться виртуальным консультантом.

Оглавление пособия по биологии за 8 класс Пасечник

Перед учителем стоит задача дать учащимся максимальное количество знаний по предмету. Для этого у него есть специальные учебные материалы, предусмотренные программой. В учебнике находится большое количество тем, которые предстоит пройти ученикам:

  1. Обзор человеческого организма и наук, изучающих его, состав и строение тела.
  2. Строение живых клеток, их химический состав и жизнедеятельность.
  3. Ткани и системы органов, нервная и гуморальная регуляция, скелет.
  4. Соединение костей в скелете, работа опорно-двигательной системы, туловище.
  5. Растяжение связок, вывихи, переломы и первая помощь при их возникновении.
  6. Значение крови, кровообращение, легкие, пищеварение, органы чувств и многое другое.

Восьмиклассники подробно рассмотрят организм человека и узнают о принципах работы всех систем в ней. Это поможет намного лучше узнать свое тело и понять, каким образом происходят те или иные действия в нем.

Помощь в решении сложных заданий

Биология учит детей не только интересоваться окружающим миром и строением различных живых существ, но и вести здоровый образ жизни. Это достигается за счет подробного разбора строения всех органов и систем, а также болезней, которые в них могут возникать. Помимо этого, во время уроков учащимся расскажут о вредных привычках, которые могут пагубно сказаться на здоровье в будущем. Чтобы закрепить пройденный материал за определенное время, школьникам предлагается выполнить тесты, которые содержат тематические вопросы по всем изученным параграфам. Все задания к ним находятся в сборнике контрольно-измерительных материалов. С помощью ГДЗ восьмиклассники могут заранее решить пробные варианты и посмотреть верные ответы на каждый номер.

Выполнение упражнений с решебником по биологии для 8 класса авторы: В. В. Пасечник, А. А. Каменский, Г. Г. Швецов

Использование онлайн-гдз приносит своим пользователям исключительно пользу, поскольку помогает получить множество полезных знаний онлайн, повысить уровень успеваемости, найти ответы на все упражнения, с легкостью справляться с домашними заданиями. Каждый восьмиклассник может открыть решебник и получить дополнительную информацию по каждой теме, изучаемой на уроках. Восьмиклассники, которые с пятого класса изучают такой интересный предмет, как биология, в этом году будут осваивать одну из самых серьезных и трудных тем – «Организм человека». Отличным помощником в изучении станут онлайн-гдз.

Для чего нужен данный сборник ГДЗ

Во-первых, нагрузка на школьников в 8 классе колоссальная. Ребенок испытывает постоянный стресс, так как не может все успеть. И очень хорошо, что сегодня у подростка есть такая возможность — совершенно легально и самостоятельно «подсмотреть» правильное решение, и быть спокойным за правильность выполнения своего домашнего задания. Во-вторых, ни для кого не секрет, что в наших школах редко ставят биологию профильным предметом. Тогда, чтобы дальше учиться на врача, фармаколога или ветеринара, старшекласснику надеяться можно только на себя, то есть, готовиться к экзаменам самостоятельно. И вот здесь единственным качественным и реальным помощником становится сборник ГДЗ, о котором идет речь, доступный в онлайн-режиме 24/7. Именно этот решебник не только поможет обеспечить хорошие оценки на экзаменах, но и сохранить достаточное количество нервных клеток.

Структура умк привязана к страницам, в каждой из которых находятся ссылки на задания. Всего их с упражнениями и разъяснением ответов – 135. Основными преимуществами данного онлайн-решебника являются:

  1. Охват всего курса школьной программы при полном соответствии учебнику по биологии 8 класса. В том числе, и тех же авторов.
  2. Качественный контент (отсутствие в решебнике описок и опечаток), что только способствует получению школьником отметки «отлично».
  3. Постоянный онлайн-доступ к сборнику ГДЗ. Необходимо лишь наличие интернета.
  4. Удобный помощник при подготовке к контрольным, самостоятельным или экзаменам.
  5. Наличие нескольких вариантов решений задач, расположенных по нарастанию сложности.

Однозначно, применение такой системы обучения, развивает у старшеклассников и самостоятельность, и дисциплину, и самоконтроль.

ГДЗ по Биологии 8 класс Колесов, Маш, Беляев | Oтветы на 5 баллов | Задание Лабораторные работы

Смотреть правильно оформленное решениe и ответ на задание Лабораторные работы по биологии 8 класс автор(ы) Колесов, Маш, Беляев

Содержание

  • Микроскопическое строение кости
  • Утомление при статической работе
  • Осанка и плоскостопие
  • Изучение особенностей кровообращения
  • Функциональная проба. Реакция сердечно-сосудистой системы на дозированную нагрузку
  • Действие слюны на крахмал
  • Установление зависимости между нагрузкой и уровнем энергетического обмена по результатам функциональной пробы с задержкой дыхания до и после нагрузки
  • Выработка навыка зеркального письма как пример разрушения старого и образования нового динамического стереотипа
  • Измерение числа колебаний образа усечённой пирамиды (рис. 155) в различных условиях

Микроскопическое строение кости

Стр. 69

Оборудование: микроскоп, постоянный препарат «Костная ткань»

Ход работы:

1. Рассматриваем при малом увеличении микроскопа костную ткань. С помощью рисунка 23, А и Б определяем, поперечный или продольный срез мы рассматриваем.

2. Находим канальцы, по которым проходили сосуды и нервы. На поперечном срезе они имеют вид прозрачного кружка или овала. На продольном срезе – вид продолговатых полых образований внутри кости, которые тянутся внутрь нее, разветвляются и постепенно становятся тонкими.

3. Находим костные клетки, которые находится между кольцами, и имеют вид черных паучков. Они выделяют пластинки костного вещества, которые потом пропитываются минеральными солями.

4. Вывод:

Мы рассмотрели при малом увеличении микроскопа костную ткань. На рисунке 23 А мы увидели продольный срез. На рисунке 23 Б – поперечный срез. Канальцев, по которым проходили сосуды и нервы, больше содержится в губчатом веществе кости. Однако и в компактном они также есть. Костными клетками заполнено почти все видимое пространство на обеих картинках.

Можно сделать вывод, что строение компактного вещества в кости обусловлено тем, что в нем пролегают нервы и сосуды, которые питают эту кость. Такое строение обеспечивает за счет полости трубочек наименьшую плотность, но высокую прочность, так как эти трубочки имеют малый вес, высокую прочность и ветвистую структуру. Последний аспект обеспечивает максимальную прочность, ведь осевая нагрузка распределяется не в одном направлении, а постепенно уменьшается. Именно по такому типу изготавливают и корпуса самолетов. Для них используют прочные дюралюминиевые конструкции, а не листовой прокат.

Утомление при статической работе

Стр. 94

Оборудование: секундомер, груз 4 – 5 кг (если взят портфель с книгами, то надо предварительно определить его массу).

Наблюдение признаков утомления при статической работе. Выясните, за какое время наступает предельное утомление.

Ход работы:

  1. Становимся лицом к классу, вытягиваем руку в сторону строго горизонтально. Мелом на доске отмечаем тот уровень, на котором находится рука.

  2. После приготовлений по команде включаем секундомер, и начинаем удерживать груз на уровне отметки.

  3. Начальное время указываем в первой строчке таблицы. Затем определяем фазы утомления и проставляем их время.

  4. Выясняем, за какое время наступает предельное утомление. Записываем показатели в таблицу.

Отсутствие утомленияРука с грузом неподвижна3 минуты
Первая фаза утомленияРука немного опускается, а потом рывком поднимается в исходное положение8 минут
Вторая фаза утомленияДрожь в руке, пошатывание корпуса тела, повышение потоотделения, потеря координации13 минут
Предельное утомлениеРука с грузом опущена, опыт завершен16 минут

Вывод: мы наблюдали за появлением признаков утомления при статической работе, определяли время наступления первой и второй фаз утомления, а также предельного утомления. Статическая работа подразумевает испытание выносливости тела человека, ведь оно находится определенное время в одном положении.

Осанка и плоскостопие

Стр. 98

1. Выявление нарушений осанки

Оборудование: сантиметровая лента.

Ход работы:

1. Для выявления сутулости (круглой спины) сантиметровой лентой было измерено расстояние между самыми отдаленными точками левого и правого плеча, а после, отступя на 3 – 5 см вниз от плечевого сустава, со стороны груди и со стороны спины. Первый результат – 63 см разделили на второй – 61 см:

63/61 = 1,033.

Вывод: нарушений нет.

2.Была выполнена требуемая поза – встать спиной к стенке так, чтобы пятки, колени, таз и лопатки касались стены. Попытка просунуть между спиной и стеной кулак не удалась. Попытка просунуть между спиной и стеной ладонь – удалась.

Вывод: нарушений осанки не выявлено.

2.Выявление плоскостопия

Оборудование: таз с водой, лист бумаги, фломастер или простой карандаш.

Ход работы:

После проведения манипуляций, указанных в задании, было выяснено, что в узкой части отпечатка стопы нет выпадов за пределы линии.

Вывод: плоскостопия нет.

Изучение особенностей кровообращения

Стр. 138

I. Функция венозных клапанов

Предварительные пояснения.

Если рука опущена, венозные клапаны не дают крови стечь вниз. Клапаны раскрываются лишь после того, как в ниже лежащих сегментах накопится достаточное количество крови, чтобы открыть венозный клапан и пропустить кровь вверх, в следующий сегмент. Поэтому вены, по которым кровь движется против силы тяжести, всегда набухшие.

Ход опыта:

Я поднимаю одну руку вверх, а вторую опускаю вниз. Спустя минуту кладу обе руки на стол.

Ответы на вопросы:

1. Почему поднятая рука побледнела, а опущенная – покраснела?

Рука, которая была опущена вниз, стала красной, потому что вены в ней наполнились кровью. Такое явление происходит из-за того, что сердце вынуждено преодолевать силу тяжести руки.

Рука, которая была поднята вверх, побелела, так как действие силы тяжести на нее совпало с направлением движения крови, которая не застаивается и не давит на стенки вен и капилляров.

2. В поднятой или опущенной руке клапаны вен были закрыты?

Клапаны закрыты были в опущенной руке, потому что кровь поднимается вверх по руке по венам, а возвращается по венам большого круга к сердцу. Клапаны служат своеобразной преградой и дают крови стекать обратно, тем самым способствуя ее движению в едином направлении.

Вывод:

Опустив руку вниз, я увидел, что она стала красной. Так произошло, потому что сердцу приходится преодолевать дополнительно силу тяжести руки. Плюс, кровь в венах застаивается, а давление на ее стенки становится сильнее.

Рука, которая была поднята вверх, стала бледной. Такое явление поясняется тем, что ее сила тяжести совпадает с направлением движения крови, которая не застаивается и не давит на стенки капилляров и вен.

Когда я положил обе руки на стол, они стали находится немного выше уровня сердца. Это способствовало тому, что стенки сосудов уменьшились, давление снизилось, обе руки приобрели здоровый естественный вид.

II. Изменения в тканях при перетяжках, затрудняющих кровообращение (рис. 64).

Оборудование: аптечное резиновое кольцо или нитки.

Ход опыта:

  1. Я перетягиваю палец с помощью нитки и провожу наблюдения за изменением цвета кожи и другими изменениями. Палец становится набухшим, красным, на ощупь плотным, появляется болезненность. Так происходит из-за того, что нить затрудняет отток крови по венам, а лимфы – по лимфатическим узлам. Если дольше держать палец перетянутым, он может посинеть, так как такая перетяжка не перекрывает полностью приток крови к пальцу, однако полностью прекращает отток крови обратно к сердцу.

  2. Дотрагиваюсь перетянутым пальцем до какого-либо предмета. Наблюдаю за ответной реакцией своего пальца – ощущение щекотки, легкого покалывания. Так объясняется кислородное голодание тканей пальца.

  3. После этого я снимаю перетяжку ниткой и массирую палец по направлению к сердцу. Движение крови по капиллярам восстанавливается, состояние кожи пальца становится прежним.

Ответы на вопросы:

1. Почему вредно туго затягиваться ремнем, носить тесную обувь?

Потому что это не только доставляет дискомфорт и неудобство, но и препятствует нормальному кровоснабжению сдавленных органов, тканей. А это чревато кислородным голоданием и даже отмиранием.

2. Почему вышли из моды корсеты, которые затягивались дамы XIX столетия?

Корсеты – это уникальные приспособления, которые носили девушки тех веков, дабы придать своей фигуре стройности и подтянутости. Однако они сильно перетягивали грудную и брюшную полости, из-за чего в них нельзя было нормально дышать, двигаться и долгое время находиться.

Вывод:

Если сильно затянуть палец ниткой, то отток крови нарушается. Возникает дискомфорт, покраснение кожи, болевые ощущения. Длительное нахождение пальца в таком состоянии чревато кислородным голоданием и, как следствие, отмиранием ткани. После того, как нить с пальца была снята, кровоснабжение в нем восстановилось, а кожа приобрела прежний вид.

Функциональная проба. Реакция сердечно-сосудистой системы на дозированную нагрузку

Стр. 157

Оборудование: секундомер или часы с секундной стрелкой.

Предварительные пояснения:

Цель этой работы — познакомиться с функциональными пробами, позволяющими выяснить степень тренированности своего сердца. Для этого измеряют частоту сердечных сокращений (ЧСС) в состоянии покоя и после дозированной нагрузки. На большом статистическом материале выяснено, что у здоровых подростков (после 20 приседаний) ЧСС возрастает на 1/3 по сравнению с состоянием покоя и нормализуется спустя 2-3 минуты после окончания работы. Зная эти данные, можно проверить состояние своей сердечно-сосудистой системы.

Ход опыта:

1. Измеряем пульс в состоянии покоя. Для этого делаем 3-4 измерения за
10 секунд, и среднее значение умножаем на 6.

2. Делаем 20 приседаний в быстром темпе, садимся и тут же измеряем ЧСС за 10 секунд.

3. Повторяем замеры через каждые 20 секунд. Определяем ЧСС за 10 секунд. (При замерах 20 секунд отсчитываем от конца предшествующего измерения).

4. Результаты оформляем в таблице:

Покой

13; 12; 11.

12 * 6 = 72

После приседаний23; 18; 15; 12.

Вывод: после проведения опыта я могу сказать, что после физической нагрузки на мой организм ЧСС повысилась за счет увеличения частоты сердечных сокращений. Мои результаты замеров ЧСС после приседаний повысились почти в два раза. Это средний результат. Спустя 10, 20 и 30 минут после завершения приседаний я наблюдал, что пульс нормализовался.

Действие слюны на крахмал

Стр. 211

Оборудование: накрахмаленный бинт, нарезанный на куски длиной 10 см, вата, спички, блюдце, раствор йода (5%-ы), вода.

Предварительные пояснения. Цель этого опыта – показать, что ферменты слюны способны расщеплять крахмал. Известно, что крахмал с йодом дает интенсивное синее окрашивание, по которому нетрудно узнать, где крахмал сохранился. При обработке крахмала ферментами слюны он разрушается, если ферменты активны. В этих местах крахмала не остается, поэтому они не откраиваются йодом и остаются светлыми.

Ход работы:

  1. Готовим реактив на крахмал – йодную воду. Добавляем несколько капель йода в воду до получения жидкости цвета крепкого заваренного чая.

  2. Наматываем на спичку вату, смачивая ее слюной. Далее пишем ватой букву на накрахмаленном бинте.

  3. Расправленный бинт зажимаем в руках и держим его некоторое время, чтобы он нагрелся (1-2 минуты).

  4. Опускаем бинт в йодную воду, тщательно расправив его. Участки, где остался крахмал, окрашиваются в синий цвет, а места, обработанные слюной, останутся белыми, так как крахмал в них распался до глюкозы, которая под действием йода не дает синего окрашивания. На синем фоне получилась белая буква.

Ответы на вопросы:

  1. Субстратом является крахмал, а ферментом будет амилаза в составе слюны.

  2. Синяя буква на белом фоне при проведении опыта не получится.

  3. При кипячении слюны ферменты, которые входят в её состав, будут разрушаться. Соответственно, на крахмал слюна, которая продет процесс кипячения, действовать не будет.

Вывод: по итогу проведения опыта мы смогли увидеть, что при воздействии йода крахмал окрашивается в темно-синий цвет. Исключение составляет место, где была нанесена слюна.

Также мы видим, что на крахмале, который обработан слюной, окрашивания не произошло. Это значит, что слюна способствовала расщеплению крахмала.

Установление зависимости между нагрузкой и уровнем энергетического обмена по результатам функциональной пробы с задержкой дыхания до и после нагрузки

Стр. 245

Оборудование: секундомер или часы с секундной стрелкой.

Ход работы:

  1. В положении сидя задерживаем дыхание при вдохе на максималь­ный срок. Включаем секундомер (предварительное глубокое дыха­ние перед опытом не допускается!). Мой результат – 37 секунд.

  2. Выключаем секундомер в момент восстановления дыхания. Записываем результат. Отдыхаем 5 мин.

  3. Встаем и делаем 20 приседаний за 30 секунд.

  4. Вдыхаем, быстро задерживаем дыхание и включаем секундомер, не дожидаясь, пока дыхание успокоится, садимся на стул.

  5. Выключаем секундомер при восстановлении дыхания. Записываем результат. Вычисления делаю следующим образом: (15*10)/37 = 40,05% или округляем 40,1%.

  6. Спустя минуту повторяем первую пробу. Результат записываем. В этот раз результат составляет 42 секунды, что в процентном соотношении будет равно: (37*100)/42 = 88,09% или округляем 88,1%.

  7. Делаем в тетради расчеты по формулам, приведенным в пунктах 3 и 5 протокола. Сравниваем свои результаты с таблицей и делаем вывод. После проведенного опыта функциональной пробы с задержкой дыхания до и после дозированной нагрузки, а также сравнив свои показатели с нормативами, я могу отнести себя к группе «Здоровые нетренированные». Чтобы в будущем улучшить свои показатели, мне нужно тщательно поработать над собой: чаще гулять на свежем воздухе, больше двигаться, заниматься спортом, например, футболом.

Ответы на вопросы:

1. Почему при задержке дыхания в крови накапливается углекислый газ?

Потому что при дыхании выделяется углекислый газ. Если будет задержка дыхания, то углекислый газ не сможет выделяться из организма, а будет накапливаться там.

2. Почему при определенной концентрации углекислого газа в крови дыхание восстанавливается непроизвольно?

Дыханием управляет дыхательный центр в продолговатом мозге. Он получает импульсы, которые информируют о насыщенности крови кислородом и углекислым газом. Когда мозг понимает, что концентрация углекислого газа повышается, он задает команду дышать. Соответственно, человек не может контролировать данный процесс по своему желанию.

3. Как углекислый газ воздействует на дыхательный центр?

Возрастает количество вдохов, они становятся глубокими, так как мозг посылает сигнал организму «дышать», чтобы пополнить запасы кислорода в крови.

4. Почему эти воздействия называются гуморальными?

Потому что эти воздействия связаны с взаимодействием химических молекул, а не нервных импульсов.

5. Почему после работы удается задержать дыхание на меньшее вре­мя, чем в состоянии покоя?

Потому что организм терпит физические нагрузки, при которых сердце бьётся быстрее, а значит, и кровь бежит быстрее. Из-за этого организму требуется больше кислорода.

6. Почему у тренированного человека энергетический обмен проис­ходит более экономно, чем у человека нетренированного?

Общий расход энергии у тренированного человека будет почти на 10-15% ниже, чем у нетренированного. Понижение таких затрат связано с улучшением вентиляции легких, уменьшением количество потребляемого кислорода. Натренированный человек может лучше расслаблять и напрягать свои мышцы. Для нетренированного человека такие манипуляции связаны с дополнительными затратами энергии.

Выработка навыка зеркального письма как пример разрушения старого и образования нового динамического стереотипа

Стр. 342

Условия работы:

Опыт можно проводить одному, но лучше, если он проводится в присутствии других людей. Тогда более отчетливо проявляются эмоциональные компоненты, связанные с перестрой­кой динамического стереотипа.

Ход работы:

  1. Измеряем, сколько секунд потребуется, чтобы написать скоро­писью какое-либо слово, например «Психология».

  2. С правой сторо­ны ставим затраченное время.

  3. Предлагаем испытуемому написать то же слово зеркальным шриф­том: справа налево. Писать надо так, чтобы все элементы букв были повернуты в противоположную сторону. Делаем 10 попыток, око­ло каждой из них с правой стороны ставим время в секундах.

Оформление результатов:

Строим график. На оси X (абсциссе) отмечаем порядковый но­мер попытки, на оси У (ординате) — время, которое было потрачено на написание очередного слова.

Считаем, сколько разрывов между буквами было при написа­нии слова обычным способом, сколько разрывов стало при первой и последующих попытках написания слова справа налево. Отметьте, в каких случаях возникают эмоциональные реакции: смех, жестикуляция, попытка бросить работу и др. Называем число букв, в которых встречаются элементы, написан­ные старым способом.

Обычным способомСпособом зеркального письма
6Попытки
12345678910
424039,53837,536,236353330

[CHART]

Вывод: при написании слова «Психология» обычным способом организм не ощущает дискомфорт. Все выполняется автоматически и занимает всего 6 секунд. При написании слова «Психология» зеркальным шрифтом справа налево организм начинает учиться новым действиям, затрачивается дополнительное время на написание каждого элемента буквы. Происходит угасание выработанных условно-рефлекторных реакций. С каждой попыткой навык обратного письма улучшается, а потому времени затрачивается меньше.

Ответы:

1. Какие факты говорят, что при разрушении динамического стереотипа происходит распад общей деятельности на отдельные элементы, например слово, написанное ранее одним росчерком, выписывается теперь по буквам?

При написании слова новым росчерком происходит обдумывание движений по выведению той или иной буквы.

2. Делаются ли при формировании нового динамического стереотипа попытки соединять буквы без дополнительной инструкции? Нужны ли эти инструкции для овладения приемами рационального письма?

Да, такие попытки делаются, происходит формирование нового динамического стереотипа, а потому все действия выполняются без инструкции.

3. В чем выражалась «борьба» между стереотипами – вновь создаваемым и старым, хорошо закрепленным? Об этом можно судить по наличию элементов букв, написанных по-старому.

При написании слова в зеркальном отражении старый стереотип держится долго, но потом он уступает место новому – происходит повторение одного и того же раздражителя. В результате образуется новый навык, который продолжает конкурировать со старым.

Измерение числа колебаний образа усечённой пирамиды (рис. 155) в различных условиях

Стр. 363

Оборудование: секундомер или часы с секундной стрелкой.

Ход работы:

  1. Попытаемся представить усеченную пирамиду, обращенную усеченным концом к нам и от нас.

  2. Когда оба образа сформированы, они сменяют друг друга: пирамида кажется то обращенной к нам, то от нас.

  3. При каждом изменении образа заносим в тетрадь штриховую черту, не глядя в нее. Отрывать глаза от рисунка нельзя!

  4. По числу колебаний этих образов можем судить об устойчивости внимания. Для экономии времени измеряем число колебаний за 30 секунд и результат удваиваем.

  5. Составляем таблицу:

30 секунд1 минута
Непроизвольное внимание (без установки)1220
Произвольное внимание (с установкой сохранять создавшийся образ)610
Произвольное внимание при активной работе с объектом48

ГДЗ по биологии для 8 класса от Путина

  • Биология 8 класс рабочая тетрадь Д.В. Колёсов

    авторы: Д.В. Колёсов Р.Д. Маш

  • Биология 8 класс Рабочая тетрадь Сонин Н. И.

    авторы: Сонин Н.И. Сапин М.Р.

  • Биология 8 класс рабочая тетрадь Сухорукова Л.Н.

    авторы: Сухорукова Л.Н. Кучменко В.С.

  • Биология 8 класс рабочая тетрадь Н.Д. Лисов

    авторы: Н.Д. Лисов З.И. Шелег

  • Биология 8 класс Сонин Н.И.

    авторы: Сонин Н.И. Сапин М.Р.

  • Биология 8 класс рабочая тетрадь Н.И. Сонин

    авторы: Н.И. Сонин М.Р. Сапина

  • Биология 8 класс Сонин Н. И.

    авторы: Сонин Н.И. Захаров В.Б.

  • Биология 8 класс Д.В. Колесов

    авторы: Д.В. Колесов Р.Д. Маш

  • Биология 8 класс рабочая тетрадь Р.Д. Маш

    авторы: Р.Д. Маш А.Г. Драгомилов

  • Биология 8 класс рабочая тетрадь А.И. Никишов

    автор: А.И. Никишов

  • Биология 8 класс Л.В. Камлюк

    авторы: Л.В. Камлюк Е.С. Шалапенок

  • Биология 8 класс В. В. Пасечник

    авторы: В. В. Пасечник А. А. Каменский

  • Биология 8 класс Беркинблит М.Б.

    автор: Беркинблит М.Б.

  • Биология 8 класс Школа 2100 Вахрушев А.А.

    авторы: Вахрушев А.А. Родионова Е.И.

  • Биология 8 класс Каменский А.А.

    авторы: Каменский А.А. Сарычева Н.Ю.

  • Биология 8 класс рабочая тетрадь Т.С. Сухова

    авторы: Т.С. Сухова Н.Ю. Сарычева

  • Биология 8 класс Любимова З.В.

    авторы: Любимова З. В. Маринова К.В.

  • Биология 8 класс контрольно-измерительные материалы Богданов Н.А.

    автор: Богданов Н.А.

  • Биология 8 класс тетрадь для лабораторных работ и самостоятельных упражнений Липатникова В.А.

    авторы: Липатникова В.А. Сысолятина Н.Б.

  • Биология 8 класс рабочая тетрадь Захаров В.Б.

    авторы: Захаров В.Б. Сонин Н.И.

  • Биология 8 класс Сухорукова Л. Н.

    авторы: Сухорукова Л. Н. Кучменко В. С.

  • Биология 8 класс тетрадь-практикум Сухорукова Л. Н.

    авторы: Сухорукова Л. Н. Кучменко В. С.

  • Биология 8 класс тетрадь-экзаменатор Сухорукова Л. Н.

    авторы: Сухорукова Л. Н. Кучменко В. С.

  • Биология 8 класс рабочая тетрадь М.Б. Жемчугова

    авторы: М.Б. Жемчугова Н.И. Романова

  • Биология 8 класс Жемчугова М.Б.

    авторы: Жемчугова М.Б. Романова Н.И.

  • Биология 8 класс тетрадь для лабораторных работ Амахина Ю.В.

    автор: Амахина Ю.В.

  • Биология 8 класс рабочая тетрадь Маш Р. Д.

    авторы: Маш Р.Д. Драгомилов А.Г.

  • Биология 8 класс Драгомилов А.Г.

    авторы: Драгомилов А.Г. Маш Р.Д.

ГДЗ ЛОЛ по Биологии за 8 класс, спиши ответ онлайн

Биология 8 класс Школа 2100 Вахрушев А.А.

Авторы: Вахрушев А.А. Родионова Е.И.

Издательство: Баласс 2016

Биология 8 класс В. В. Пасечник

Авторы: В. В. Пасечник А. А. Каменский

Издательство: Просвещение 2016

Биология 8 класс Сонин Н.И.

Авторы: Сонин Н.И. Захаров В.Б.

Издательство: Дрофа

Биология 8 класс Тетрадь-тренажер Сухорукова Л. Н.

Авторы: Сухорукова Л.Н. Кучменко В.С.

Издательство: Просвещение 2015

Биология 8 класс Беркинблит М.Б.

Автор: Беркинблит М.Б.

Издательство: Бином 2013

Биология 8 класс рабочая тетрадь Н.Д. Лисов

Авторы: Н.Д. Лисов З.И. Шелег

Издательство: Аверсэв 2015

Биология 8 класс Л.В. Камлюк

Авторы: Л.В. Камлюк Е.С. Шалапенок

Издательство: Народная асвета 2010

Биология 8 класс рабочая тетрадь А.И. Никишов

Автор: А.И. Никишов

Издательство: Владос 2017

Биология 8 класс Каменский А.А.

Авторы: Каменский А.А. Сарычева Н.Ю.

Издательство: Вентана-граф 2014

Биология 8 класс рабочая тетрадь Т. С. Сухова

Авторы: Т.С. Сухова Н.Ю. Сарычева

Издательство: Вентана-граф 2016

Биология 8 класс Любимова З.В.

Авторы: Любимова З.В. Маринова К.В.

Издательство: Владос 2014

Биология 8 класс контрольно-измерительные материалы Богданов Н.А.

Автор: Богданов Н.А.

Издательство: ВАКО 2017

Биология 8 класс тетрадь для лабораторных работ и самостоятельных упражнений Липатникова В.А.

Авторы: Липатникова В.А. Сысолятина Н.Б.

Издательство: Дрофа 2016

Биология 8 класс рабочая тетрадь Захаров В.Б.

Авторы: Захаров В.Б. Сонин Н.И.

Издательство: Дрофа 2018

Биология 8 класс Сухорукова Л. Н.

Авторы: Сухорукова Л. Н. Кучменко В. С.

Издательство: Просвещение 2014

Биология 8 класс тетрадь-практикум Сухорукова Л. Н.

Авторы: Сухорукова Л. Н. Кучменко В. С.

Издательство: Просвещение 2017

Биология 8 класс тетрадь-экзаменатор Сухорукова Л. Н.

Авторы: Сухорукова Л. Н. Кучменко В. С.

Издательство: Просвещение 2016

Биология 8 класс рабочая тетрадь М.Б. Жемчугова

Авторы: М.Б. Жемчугова Н.И. Романова

Издательство: Русское слово 2017

Биология 8 класс Жемчугова М.Б.

Авторы: Жемчугова М.Б. Романова Н.И.

Издательство: Русское слово 2018

Биология 8 класс тетрадь для лабораторных работ Амахина Ю. В.

Автор: Амахина Ю.В.

Издательство: Русское слово 2017

Биология 8 класс рабочая тетрадь Маш Р.Д.

Авторы: Маш Р.Д. Драгомилов А.Г.

Издательство: Вентана-граф 2016-2018

Биология 8 класс Драгомилов А.Г.

Авторы: Драгомилов А.Г. Маш Р.Д.

Издательство: Вентана-граф 2018

Биология 8 класс Соболь В.И.

Автор: Соболь В.И.

Издательство: Абетка 2016

Биология 8 класс рабочая тетрадь Колесов Д.В.

Авторы: Колесов Д.В. Маш Р.Д.

Издательство: Дрофа 2018

Биология 8 класс рабочая тетрадь Пасечник В.В.

Авторы: Пасечник В.В. Швецов Г.Г.

Издательство: Просвещение 2016

Биология 8 класс Сонин Н. И.

Авторы: Сонин Н.И. Сапин М.Р.

Издательство: Дрофа 2018

Биология 8 класс тетрадь для лабораторных и практических работ Сысолятина Н.Б.

Авторы: Сысолятина Н.Б. Сычева Л.В.

Издательство: Дрофа 2018

Биология 8 класс рабочая тетрадь Сонин Н.И.

Авторы: Сонин Н.И. Агафонова И.Б.

Издательство: Дрофа 2019

Биология 8 класс Колесов Д.В.

Авторы: Колесов Д.В. Маш Р.Д.

Издательство: Дрофа 2018

Биология 8 класс Константинов В.М.

Авторы: Константинов В.М. Бабенко В.Г.

Издательство: Вентана-граф 2015

Биология 8 класс рабочая тетрадь Суматохин С.В.

Авторы: Суматохин С. В. Кучменко В.С.

Издательство: Вентана-граф 2016

Биология 8 класс Соловьёва А.Р.

Авторы: Соловьёва А.Р. Ибрагимова Б.Т.

Издательство: Атамұра 2018

Биология 8 класс Сивоглазов В.И.

Авторы: Сивоглазов В.И. Каменский А.А.

Издательство: Просвещение 2019

Биология 8 класс практические занятия Никишов А.И.

Автор: Никишов А.И.

Издательство: Владос 2013

Биология 8 класс задачник-практикум Родионова Е.И.

Авторы: Родионова Е.И. Вахрушев А.А.

Издательство: Баласс 2016

Биология 8 класс Рохлов В.С.

Авторы: Рохлов В.С. Трофимов С.Б.

Издательство: Мнемозина 2019

Биология 8 класс В. В. Латюшин

Авторы: В.В. Латюшин В.А. Шапкин

Издательство: Дрофа 2020

Биология 8 класс Сивоглазов В.И.

Авторы: Сивоглазов В.И. Сапин М.Р.

Издательство: Дрофа 2020

Биология 8 класс рабочая тетрадь Н.Ф. Бодрова

Автор: Н.Ф. Бодрова

Издательство: М-книга 2017

Биология 8 класс Шереметьева А.М.

Авторы: Шереметьева А.М. Рокотова Д.И.

Издательство: Академкнига 2018

Биология 8 класс рабочая тетрадь (Животные) Никишов А.И.

Автор: Никишов А.И.

Издательство: Просвещение 2021

Уровень: Для обучающихся с интеллектуальными нарушениями

Биология 8 класс Никишов А. И.

Авторы: Никишов А. И. Теремов А. В.

Издательство: Просвещение 2021

Уровень: Для обучающихся с интеллектуальными нарушениями

Биология 8 класс Тестовые задания Е.А. Солодова

Автор: Е.А. Солодова

Издательство: Вентана-граф 2019

Биология 8 класс рабочая тетрадь В.И. Сивоглазов

Автор: В.И. Сивоглазов

Издательство: Просвещение 2021

Биология 8 класс рабочая тетрадь И.А. Демичева

Автор: И.А. Демичева

Издательство: Просвещение 2021

Биология 8 класс А.В. Теремов

Авторы: А.В. Теремов И.А. Жигарев

Издательство: Просвещение 2021

ГДЗ по биологии для 8 класса от Спиши фан

  • Рабочая Тетрадь по биологии 8 класс А.И. Никишов

    Автор: А.И. Никишов

  • Решебник по биологии 8 класс Л.В. Камлюк

    Авторы: Л.В. Камлюк, Е.С. Шалапенок

  • Решебник по биологии 8 класс Сонин Н.И.

    Авторы: Сонин Н.И., Захаров В.Б.

  • Рабочая Тетрадь по биологии 8 класс Н.Д. Лисов

    Авторы: Н.Д. Лисов, З.И. Шелег

  • Решебник по биологии 8 класс Беркинблит М.Б.

    Автор: Беркинблит М.Б.

  • Школа 2100 по биологии 8 класс Вахрушев А.А.

    Авторы: Вахрушев А.А., Родионова Е.И., Белицкая Г.Э., Раутиан А.С.

  • Рабочая Тетрадь по биологии 8 класс Т.С. Сухова

    Авторы: Т.С. Сухова, Н.Ю. Сарычева

  • Решебник по биологии 8 класс Любимова З.В.

    Авторы: Любимова З.В., Маринова К.В.

  • Контрольно-Измерительные Материалы (Ким) по биологии 8 класс Богданов Н.А.

    Автор: Богданов Н.А.

  • Рабочая Тетрадь по биологии 8 класс Захаров В.Б.

    Авторы: Захаров В.Б., Сонин Н.И.

  • Решебник по биологии 8 класс Сухорукова Л. Н.

    Авторы: Сухорукова Л. Н., Кучменко В. С., Цехмистренко Т. А.

  • Тетрадь-Практикум по биологии 8 класс Сухорукова Л. Н.

    Авторы: Сухорукова Л. Н., Кучменко В. С., Васина Н. А.

  • Тетрадь-Экзаменатор по биологии 8 класс Сухорукова Л. Н.

    Авторы: Сухорукова Л. Н., Кучменко В. С., Ефремова М. А.

  • Рабочая Тетрадь по биологии 8 класс М.Б. Жемчугова

    Авторы: М.Б. Жемчугова, Н.И. Романова

  • Решебник по биологии 8 класс Жемчугова М.Б.

    Авторы: Жемчугова М.Б., Романова Н.И.

  • Тетрадь Для Лабораторных Работ по биологии 8 класс Амахина Ю. В.

    Автор: Амахина Ю.В.

  • Рабочая Тетрадь по биологии 8 класс Маш Р.Д.

    Авторы: Маш Р.Д., Драгомилов А.Г.

  • Решебник по биологии 8 класс Драгомилов А.Г.

    Авторы: Драгомилов А.Г., Маш Р.Д.

  • Решебник по биологии 8 класс Соболь В.И.

    Автор: Соболь В.И.

  • Рабочая Тетрадь по биологии 8 класс Колесов Д.В.

    Авторы: Колесов Д. В., Маш Р.Д., Беляев И.Н.

  • Рабочая Тетрадь по биологии 8 класс Пасечник В.В.

    Авторы: Пасечник В.В., Швецов Г.Г.

  • Решебник по биологии 8 класс Сонин Н.И.

    Авторы: Сонин Н.И., Сапин М.Р.

  • Тетрадь Для Лабораторных И Практических Работ по биологии 8 класс Сысолятина Н.Б.

    Авторы: Сысолятина Н.Б., Сычева Л.В., Сонин Н.И.

  • Рабочая Тетрадь по биологии 8 класс Сонин Н. И.

    Авторы: Сонин Н.И., Агафонова И.Б.

  • Решебник по биологии 8 класс Колесов Д.В.

    Авторы: Колесов Д.В., Маш Р.Д., Беляев И.Н.

  • Решебник по биологии 8 класс Константинов В.М.

    Авторы: Константинов В.М., Бабенко В.Г., Кучменко В.С.

  • Рабочая Тетрадь по биологии 8 класс Суматохин С.В.

    Авторы: Суматохин С.В., Кучменко В.С.

  • Решебник по биологии 8 класс Соловьёва А. Р.

    Авторы: Соловьёва А.Р., Ибрагимова Б.Т.

  • Решебник по биологии 8 класс Сивоглазов В.И.

    Авторы: Сивоглазов В.И., Каменский А.А., Сарычева Н.Ю.

  • Практические Работы по биологии 8 класс Никишов А.И.

    Автор: Никишов А.И.

  • Задачник-Практикум по биологии 8 класс Родионова Е.И.

    Авторы: Родионова Е.И., Вахрушев А.А., Богданова Е.Д.

  • Решебник по биологии 8 класс Рохлов В. С.

    Авторы: Рохлов В.С., Трофимов С.Б.

  • Решебник по биологии 8 класс В.В. Латюшин

    Авторы: В.В. Латюшин, В.А. Шапкин, Ж.А. Озерова

  • Рабочая Тетрадь по биологии 8 класс Задорожный К.М.

    Автор: Задорожный К.М.

  • Решебник по биологии 8 класс Задорожный К.М.

    Автор: Задорожный К.М.

  • Тетрадь Для Лабораторных Работ по биологии 8 класс Сало Т. О.

    Авторы: Сало Т.О., Деревинская Л.В.

  • Решебник по биологии 8 класс Матяш Л.И.

    Авторы: Матяш Л.И., Остапченко О.М.

  • Решебник по биологии 8 класс Рыбалко Л.М.

    Авторы: Рыбалко Л.М., Корягина М.Б.

  • Решебник по биологии 8 класс Базанова Т.И.

    Авторы: Базанова Т.И., Павиченко Ю.В., Шатровский А.Г., Кузнецова Ю.О.

  • Решебник по биологии 8 класс Костылев О. В.

    Авторы: Костылев О.В., Яценко С.П.

  • Решебник по биологии 8 класс Жолос О.В.

    Авторы: Жолос О.В., Толстанова Г.М., Ягенская Г.В.

  • Рабочая Тетрадь по биологии 8 класс Вихренко М.А.

    Авторы: Вихренко М.А., Андерсон О.А., Миюс С.М.

  • Решебник по биологии 8 класс Сивоглазов В.И.

    Авторы: Сивоглазов В.И., Сапин М.Р., Каменский А.А.

  • Рабочая Тетрадь по биологии 8 класс Н. Ф. Бодрова

    Автор: Н.Ф. Бодрова

  • Решебник по биологии 8 класс Шереметьева А.М.

    Авторы: Шереметьева А.М., Рокотова Д.И.

  • Рабочая Тетрадь по биологии 8 класс Никишов А.И., Для обучающихся с интеллектуальными нарушениями

    Автор: Никишов А.И.

  • Решебник по биологии 8 класс Никишов А. И., Для обучающихся с интеллектуальными нарушениями

    Авторы: Никишов А. И., Теремов А. В.

  • Рабочая Тетрадь по биологии 8 класс В.И. Сивоглазов

    Автор: В.И. Сивоглазов

  • Рабочая Тетрадь по биологии 8 класс И.А. Демичева

    Автор: И.А. Демичева

  • Решебник по биологии 8 класс А.В. Теремов

    Авторы: А.В. Теремов, И.А. Жигарев

Curriculum Review: Real Science-4-Kids (Classs 5–8)

Просмотренные тексты:

  • Chemistry Level I  – Текст для учащихся, Руководство для учителя, Лабораторная рабочая тетрадь, Rebecca W. Keller, Albuquerque, NM: Публикации Гравитас, 2004, 2005.
  • Химия, уровень II, — текст для учащихся, руководство для учителя, лабораторная рабочая тетрадь, Ребекка В. Келлер, Альбукерке, Нью-Мексико: Gravitas Publications, 2004, 2005.
  • Физика Уровень I — Текст для учащихся, Руководство для учителя, Лабораторная рабочая тетрадь, Ребекка В. Келлер, Альбукерке, Нью-Мексико: Gravitas Publications, 2004, 2005.
  • Биология, уровень I  – текст для учащихся, руководство для учителя, лабораторная рабочая тетрадь, Ребекка В. Келлер, Альбукерке, Нью-Мексико: Gravitas Publications, 2004, 2005.

В духе подхода «Хорошо тренированный ум», заключающегося в сосредоточении внимания на одной научной теме в течение всего года, доктор Р. В. Келлер написал серию учебников, которые представляют собой интригующую альтернативу традиционным текстам.

Интеграция

Хотя учебная программа Real Science-4-Kids рекламируется на известном веб-сайте интеллектуального дизайна Access Research Network (www. arn.org), в самих текстах нет религиозного содержания. Согласно биографии автора, доступной на веб-сайте Gravitas, доктор Келлер — мама, обучающаяся на дому, и активный научный сотрудник со степенью доктора философии. из Университета Нью-Мексико. Веб-сайт не делает никаких личных религиозных заявлений об авторе.

При этом можно сделать два замечания. Во-первых, автор не пропагандирует биологическую эволюцию. Одна из ее заявленных целей — дать студентам понимание тех вопросов, на которые наука не может ответить. Можно только предполагать, что сюда входят вопросы происхождения жизни. В этом смысле Real Science-4-Kids представляет собой жизнеспособную альтернативу для тех родителей, которые хотят держаться подальше от сложного вопроса эволюции в начальной школе.

Во-вторых, автор также опускает все вопросы, связанные с вопросом о возрасте Земли. Будут опубликованы тексты по науке о Земле и астрономии, поэтому будет интересно посмотреть, как автор обращается с этими дисциплинами, учитывая, что они содержат величайшие свидетельства существования древней Земли.

Естествознание

В оценке качества естественнонаучного образования, предлагаемого программой Real Science-4-Kids, есть и хорошие, и плохие новости. Во-первых, хорошее: наука здравая. Тексты охватывают широкий спектр основных тем, которые учащиеся потребуют при повторном изучении этих тем. Материал от периодической таблицы элементов до законов движения Ньютона и всего, что между ними, получает обработку.

Вот обзор тем, затронутых в каждом учебнике серии Уровня I:

  • Химия — Материя; молекулы; Химические реакции; Кислоты, основания и рН; кислотно-щелочная нейтрализация; Смеси; разделительные смеси; молекулы энергии; полимеры; биологические полимеры; ДНК; Белки
  • Физика —Что такое физика?; сила, энергия и работа; потенциальная и кинетическая энергия; Движение; Энергия атомов и молекул; электрическая энергия и заряд; Движущиеся электрические заряды и тепло; Магниты и электромагниты; свет и звук; Сохранение энергии
  • Биология — Живые существа; Клетки-строительные блоки жизни; Фотосинтез; Части растения; Как растет растение; Протисты; Жизненный цикл лягушки; жизненный цикл бабочки; Наш сбалансированный мир

Gravitas Publishing также предлагает учебники по химии для Pre-Level I и Level II. Pre-Level I рекламируется как подходящий для 1-2 классов, Level I для 3-5 классов и Level II для 6-8 классов. Доктор Келлер написал учебник по химии для начального уровня I для 1-го и 2-го классов. Хотя тексты 1-го уровня (химия, физика и биология) оцениваются от 3 до 6, одаренные первоклассники, вероятно, смогут использовать учебник. Тексты I уровня с поддержкой. Доктор Келлер также написал учебник по химии для начального уровня I для 1 и 2 классов и выпустил курс «Химия II», за которым вскоре последуют «Физика II» и «Биология II». Примеры глав можно загрузить с веб-сайта Gravitas для ознакомления.

Еще один положительный момент заключается в том, что, поскольку автор избегает вопросов о возрасте Земли, она может избежать целого ряда тем, связанных с наземными минами. Это предотвращает попадание текстов во многие ловушки, в которые попадают тексты по креационной науке.

Искусство преподавания

Основным преимуществом учебной программы Real Science-4-Kids является то, что она сосредоточена на одной теме в течение всего года, в отличие от обычного шестинедельного формата опроса, который используется большинство других учебников по естественным наукам. Понятия могут закрепляться в течение более длительного периода времени. Мы надеемся, что этот метод обучения улучшит запоминание и облегчит более глубокое изучение ключевых тем. Каждый текст содержит всего 10 уроков, поэтому, если ученик проявляет живой интерес к той или иной теме, темп текста не настолько строгий, чтобы не мешать коротким экскурсам в более углубленное изучение.

Тексты имеют сдержанный, но привлекательный формат, который визуально разбивает сложные концепции на небольшие кусочки. Несмотря на то, что используется неформальный шрифт, презентация проста для понимания и не перегружена неподходящими рисунками. Акцент делается на контенте, а не на развлечениях.

Семья рецензента изучала химию I с нашей дочерью в первом классе и физику I во втором классе. Роберт (муж рецензента) выполнял все научные инструкции в течение обоих лет. Он нашел содержание текстов точным и хорошим фундаментом для будущих исследований. Рассмотрение каждой темы не слишком подробное, но, похоже, это и не является целью автора. Скорее, кажется, что доктор Келлер хочет познакомить студентов с ключевыми терминами и понятиями, с которыми они столкнутся, продолжая свое научное образование. И с учетом этой цели Real Science-4-Kids оправдывает ожидания.

При этом я (Криста) не уверен, что в самих текстах достаточно информации, чтобы я мог преподавать по этой программе. Роберт изучал физику и химию в средней школе. Я не. Таким образом, я не смог бы дополнить часто краткие пояснения в текстах дополнительным обсуждением или примерами. И я точно не смогла бы проводить эксперименты! Даже имея руководство для учителя, учитель без солидного научного образования может счесть эту учебную программу сложной.

Учебная программа Real Science-4-Kids написана для домашнего обучения, но может быть адаптирована к классной среде амбициозным преподавателем. Издание для учителя и рабочие листы для лабораторных работ являются неотъемлемой частью учебной программы и обязательно должны быть приобретены.

Одной из трудностей является отсутствие подробного указателя в пособиях для учителей. Тем не менее, студенческие тексты включают краткий список терминов в конце с указанием номера страницы, на которой термин обсуждается.

Дополнительные материалы

Ключевые принципы каждого урока закрепляются с помощью лабораторных заданий. По нашему опыту, большинство экспериментов сработало, хотя некоторые из них не очень практичны в домашних условиях. Некоторые лабораторные работы могут нуждаться в адаптации, чтобы соответствовать ситуации или предпочтениям пользователя. Например, в одном эксперименте учителю предлагается сделать свои собственные полоски pH для использования в лаборатории. Почему бы просто не купить что-нибудь за несколько долларов в магазине товаров для бассейна? Другой эксперимент требовал использования шариков разного веса. Их оказалось очень трудно найти даже в местном армейском магазине. В конце концов, мы импровизировали, используя игрушки разного веса.

В поставляемую учебную программу не включены тесты, но некоторые из них доступны на веб-сайте Gravitas. Студентам рекомендуется вести тетрадь для записи своих лабораторных наблюдений. Лабораторные рабочие листы не переплетены, но имеют три отверстия и легко помещаются в 2-дюймовую папку. Однако эти рабочие листы являются расходными материалами, и их необходимо будет выкупить для других учащихся. Эта тетрадь является единственным формальным «доказательством» того, что учащийся действительно выполнил уроки, поэтому она необходима тем школьникам, которым необходимо предоставить письменную документацию.

Это подводит нас к одному из наиболее неприятных аспектов учебного плана Real Science-4-Kids, а именно к тому, что он не включает рабочих листов. Это вызывает сожаление, поскольку рабочие листы обеспечивают дополнительный способ закрепления ключевых понятий и измерения того, насколько хорошо учащийся понимает определенные идеи. Включение рабочих тетрадей было бы полезным дополнением, чтобы восполнить этот пробел.

Заключительные мысли

В целом усилия доктора Келлера заслуживают похвалы. Серия «Настоящая наука для четырех детей» представляет собой, по сути, светский научный текст, в котором не упоминается как биологическая эволюция, так и вопросы о возрасте Земли. Эта учебная программа, вероятно, больше всего понравится тем родителям, которые уверены в своих научных знаниях и предпочитают подход с погружением в один предмет и хотят выйти за рамки обычных шестинедельных занятий для естественнонаучного образования своего ребенка. Но учителя должны быть готовы заполнить некоторые пробелы дополнительной информацией, включая поездки в библиотеку, дополнительные рабочие листы и эксперименты. Преподаватели, которые не так уверены в своем уровне естественнонаучного образования, возможно, захотят рассмотреть другой вариант.


Эта статья была первоначально опубликована в ресурсе Преподавание науки с христианской точки зрения .

Моделирование с высоким разрешением на основе данных и пространственный анализ пандемии COVID-19 в Германии

  • Список журналов
  • PLoS Один
  • PMC8372931

PLoS Один. 2021; 16(8): e0254660.

Опубликовано в Интернете 18 августа 2021 г. doi: 10.1371/journal.pone.0254660

, Концептуализация, Курирование данных, Исследование, Методология, Программное обеспечение, Проверка, Визуализация, Написание — первоначальный проект, Написание — обзор и редактирование, 1 , 2 , * , Концептуализация, Привлечение финансирования, Методология, Ресурсы, Написание – первоначальный проект, Написание – обзор и редактирование, 3 , 4 , 5 и , Концептуализация, Привлечение финансирования, Исследование, Методология, Администрирование проекта, Ресурсы, Написание – обзор и редактирование 1 , 2

Эстебан Эрнандес-Варгас, редактор

Информация об авторе Примечания к статье Информация об авторских правах и лицензиях Отказ от ответственности

Дополнительные материалы
Заявление о доступности данных с вирусом SACoV-2
100 миллионов заражений на сегодняшний день, и в настоящее время многие страны борются со второй волной инфекций. Не имея достаточных возможностей вакцинации и эффективных лекарств, немедикаментозные вмешательства (НФВ) остаются мерой выбора. Однако НФУ ложатся тяжелым бременем на общество, психическое здоровье людей и экономику. Поэтому соотношение затрат и выгод должно быть тщательно сбалансировано, и достижение этого баланса может помочь целенаправленному мелкомасштабному внедрению этих НКО. С этой целью мы вводим модифицированную компартментную модель класса SEIRD и параметризуем ее локально для всех 412 округов Германии. НКО моделируются на районном уровне с помощью меняющейся во времени частоты контактов. Такое высокое пространственное разрешение позволяет применять геостатистические методы для анализа пространственных закономерностей пандемии в Германии и сравнивать результаты различных пространственных разрешений. Мы обнаружили, что модифицированная модель SEIRD может быть успешно адаптирована к COVID-19.случаев в немецких округах, землях, а также по всей стране. Мы предлагаем длину корреляции в качестве дополнительной меры, помимо еженедельных показателей заболеваемости, для описания текущей ситуации с эпидемией.

Вирус SARS-CoV-2 впервые был обнаружен в Китае в конце 2019 года, а затем стремительно распространился по миру. К марту 2020 года COVID-19, заболевание, вызываемое SARS-CoV-2, было официально объявлено Всемирной организацией здравоохранения пандемией [1]. На сегодняшний день пандемия привела к разрушительным последствиям для жизни, здоровья и национальной экономики. Новизна вируса SARS-CoV-2 в сочетании со сравнительным отсутствием клинических исследований коронавирусов в целом привела к тому, что нефармацевтические вмешательства (НФВ), такие как маски, изоляция и меры социального дистанцирования, стали основным оружием в борьбе с коронавирусом. борьба с COVID-19. Действительно, НФУ до сих пор играли важную роль в модулировании динамики пандемии [2].

В Европе и других регионах НФУ во время первой волны COVID-19 обычно внедрялись на национальном уровне или на уровне штатов в некоторых федерациях. В Германии, например, первый случай COVID-19 был зарегистрирован 27 января 2020 г. , а первые НПИ были введены 3 марта 2020 г. с закрытием большинства общественных мест, включая закрытие школ. Через две недели за этим последовал запрет на встречи с большим количеством людей за пределами собственного дома, а количество людей, одновременно допущенных в супермаркеты, было ограничено. Эти меры оказались в значительной степени эффективными [3], и первый COVID-19волна достигла пика в Германии в начале апреля 2020 года. Ослабление общенациональных НКО началось к третьей неделе апреля, а к маю 2020 года первая волна в Германии фактически закончилась. Хотя этот тип широкомасштабной стратегии развертывания NPI был успешным, он также был чрезвычайно дорогостоящим и привел к множеству непредвиденных последствий. Например, школы и университеты по всей Германии были полностью закрыты во время карантина [4]. Кроме того, ВВП, скорректированный с учетом цен и календаря, сократился на 90,7% во втором квартале 2020 г. по отношению к аналогичному периоду 2019 г. [5].

Европа в настоящее время охвачена второй волной COVID-19, и, несмотря на многие успехи, достигнутые после пика первой волны, окончательные решения, такие как достаточные возможности для вакцинации, остаются неуловимыми. В то же время разрушительные экономические, социальные и политические последствия общенациональных блокировок становятся все более очевидными. Осенью 2020 года нескоординированные меры меньшего масштаба не смогли сдержать вирус. Результатом стало повторное введение общенациональных ограничений. С одной стороны, эту неудачу можно интерпретировать как свидетельство против эффективности местных мер. С другой стороны, это дает возможность разработать более комплексные стратегии для применения НФУ в различных масштабах (например, местном, региональном, национальном) и для выявления условий, которые требуют увеличения усилий по контролю до более крупных масштабов.

Поэтому крайне важно, чтобы мы узнали как можно больше о характерных для масштаба эффектах сильных НФУ из первой волны COVID-19. Ключевым ограничением является то, что до сих пор многие анализы были сосредоточены на национальном немецком уровне [3, 6] и, таким образом, не могли выявить местные тенденции. Примером такой местной или региональной тенденции является город Йена, который первым ввел обязательное ношение масок. Эта мера, по-видимому, эффективно и очень рано остановила болезнь [7]. Другим примером является крупнейшее на сегодняшний день событие суперраспространения в Германии на мясокомбинате, которое в основном затронуло только два района [8]. Здесь мы используем данные Института Роберта Коха (RKI) [9].], представленные для каждого из 412 административных районов (т. е. округов) в Германии, для количественной оценки местного воздействия НФВ от первой волны COVID-19 и сразу после нее. В частности, мы подгоняем модифицированные компартмент-модели класса SEIRD к данным RKI на уровне района и количественно оцениваем изменения в расчетной частоте контактов для каждого района в течение периодов времени, определяемых датами начала и окончания различных НПИ, которые были реализованы. До сих пор исследования, которые моделировали COVID-19эпидемии в Германии на районном уровне сосредоточились на оценке прогностических возможностей самой модели [10–12]. Принимая во внимание, что мы используем более детализированные данные, чтобы также облегчить анализ динамики пространственных моделей кластеров инфекций, что может дать дополнительное представление о том, как COVID-19 в Германии отреагировал на NPI. Наконец, наша структура также позволяет проводить прямое многомасштабное сравнение, чтобы показать, как выводы об эффективности НКО, которые можно сделать, зависят от масштаба анализа.

В Германии RKI отвечает за сбор и публикацию данных о COVID-19. Германия разделена на 401 район, один из которых находится на Боденском озере и не имеет жителей. RKI далее делит самый густонаселенный район Берлина на 12 районов. Для простоты эти 412 районов, по которым РКИ публикует данные, отныне будут называться районами. Обязательство Германии сообщать RKI обо всех положительных тестах на COVID-19 и тот факт, что эти данные публикуются на районном уровне, позволяет моделировать эпидемию с таким сравнительно высоким пространственным разрешением. Численность населения районов взята из данных Федерального статистического управления Германии [13].

Эпидемия COVID-19 в Германии моделируется с помощью компартментальной эпидемиологической модели [14] на районном уровне. В каждом районе население делится на S Указанный , E Xposed , I Nfectious , R Ecovered и D aad , с ноткой , с D aead , с новой популяцией, с D aad , с новой популяцией и D aead , с новой популяцией и D aad , с новой популяцией. представляет собой сумму людей в отсеках за вычетом смертей, связанных с COVID-19 Н = С + Е + И + Р . Чтобы количество параметров было как можно меньше, лица, подвергшиеся воздействию, и бессимптомные случаи обрабатываются вместе в одном отделении. Модифицированная модель SEIRD формулируется как

S˙=-βjNIS

(1)

E˙=βjNIS-(α+κ)E

(2)

I˙=αE-(γ+μ)I

(3)

5

5 R˙=κE+γI

(4)

D˙=μI

(5)

Предполагается, что бессимптомные больные могут выздороветь, но не умереть от COVID-19, таким образом, уравнение (5) связано только с уравнением (3). Графическая визуализация системы уравнений (1)–(5) показана на рис.

Открыть в отдельном окне

Структура модели.

Визуальное представление уравнений (1)–(5), где различные отсеки показаны прямоугольниками, а скорости переноса показаны стрелками. Данные, собранные RKI, показаны пунктирными стрелками вместо пунктирных. Цветовая кодировка различных отсеков сохраняется неизменной на протяжении всей рукописи.

NPI моделируются кусочно-постоянной скоростью контакта β ( t ), которая может изменяться в даты реализации NPI. Без ограничения общности это предположение переформулируется в виде постоянных скоростей контактов β j , где j = 1, 2, …, M + 1 и M — общее количество NPI. β j заменяется на β j 9αЭ. Таким образом, начальное условие для отсека Exposed : E (0) = I obs / α . Для компартмента Infectious зарегистрированные случаи за последние 1/ α дней интегрируются I(0)=∫-1/α0Iobs(t)dt. Это только приблизительное значение, но оно быстро становится неактуальным, так как отделение заполнено Exposed . Recovered установлены на R (0) = 0, точно так же, как Dead D (0) = 0, так как в начальный момент не было зарегистрировано случаев смерти. Затем начальное условие для отсека Susceptible рассчитывается как S (0) = N E (0) − I (0).

Поскольку латентные и бессимптомные случаи объединены в один отсек, части структуры модели и некоторые ее параметры не могут быть легко сопоставлены с величинами, которые можно реально измерить, например, среднее время, необходимое для выздоровления бессимптомных случаев. Это решение было принято для того, чтобы количество параметров было как можно меньше, но в то же время иметь достаточно гибкую модель для воспроизведения течения COVID-19.эпидемия в разных масштабах и во всех районах Германии.

Предположения, сделанные для моделей типа SIR, не работают для небольших популяций. Поскольку число случаев заболевания в день часто уже невелико на районном уровне без разделения случаев на разные возрастные группы, мы пренебрегаем возрастным распределением населения, чтобы избежать дальнейшего сокращения числа лиц в соответствующих отделениях.

Используя матричный подход следующего поколения [15], можно рассчитать репродукционный номер для модели SEIRD, что даст

Rj=αβj(α+κ)(γ+µ)

(6)

Система нелинейных обыкновенных уравнений (1)–(5) численно решается явным методом Рунге-Кутты 5-го порядка (4), полученный Dormand et al. [16] и реализовано Virtanen et al. [17].

The M + 5 unknown parameters θ = ( α , β 1 , β 2 , … β j , γ , κ , мк ) T на район в уравнениях (1)–(5) оцениваются с использованием байесовского вывода. Для доказательства используются количество лабораторно подтвержденных случаев в день I obs и количество смертей, связанных с COVID-19 в день D obs , собранные RKI. Эти данные сгруппированы вместе как X набл. = ( I набл. , D набл. ) T . Перевод X 9мкI, где X = ( αE , мкI ) T . Предполагая распределение ошибок Пуассона, мы максимизируем его логарифмическую вероятность

L=∑i=1t(Xiln(Xobsi)-ln(Γ(Xi+1))-Xi)

(7)

где t — общее количество смоделированных дней.

Вывод параметров настроен для всех 412 районов и выборка повторяется 200000 раз для каждого из них. Априорные распределения параметров равномерны P ( θ ) ∼ U и выборка производится с использованием алгоритма Метрополиса-Гастингса MCMC [18, 19]. Первые 10% моделирования используются для классической выборки методом Монте-Карло для периода приработки. Исходя из этого, лучший набор параметров используется в качестве начального набора параметров для пробоотборника Metropolis. Для проверки сходимости используются 10 цепочек MCMC. SPOTPY [20] используется для реализации вывода параметров.

RKI собирает и обновляет данные о COVID-19эпидемия раз в сутки. Эти данные загружаются и предварительно обрабатываются, чтобы использовать их для доказательства в байесовской структуре. Далее вывод параметров выполняется для всех районов параллельно. Наконец, анализы сделаны и графики созданы. Все эти шаги являются частью полностью автоматизированного рабочего процесса на высокопроизводительном кластере EVE [21] в UFZ Leipzig.

Для сравнения с гораздо более распространенным подходом к моделированию эпидемии на национальном уровне результаты всех подходящих моделей на районном уровне агрегируются, сначала на уровне земель в пределах Германии, а затем на национальном уровне. Это дает три различных пространственных разрешения, которые затем можно сравнить: 1) районное, 2) государственное и 3) национальное. Кроме того, та же самая модель SEIRD (1)–(5), которая применялась к районам, также параметризована для национальных показателей заболеваемости и смертности для решения 3) и для 16 отдельных земель Германии для решения 2).

Мы провели анализ чувствительности, чтобы лучше понять поведение модели, используя алгоритм расширенного теста амплитудной чувствительности Фурье (FAST) [22]. Этот метод представляет собой анализ глобальной чувствительности на основе дисперсии, учитывающий взаимодействие параметров, и реализован SPOTPY [20].

Относительно высокое пространственное разрешение районов Германии позволяет использовать геостатистические методы для выявления структур пространственной корреляции. Вариограмма представляет собой функцию, описывающую тип, длину и силу этих пространственных корреляций. В рассмотренных здесь случаях вариограмма монотонно возрастает от 0 до тех пор, пока не выравнивается, когда достигает своего максимума, равного дисперсии поля. Чем больше вариограмма на определенном расстоянии, тем меньше корреляции на этом расстоянии. Если в Германии происходит только несколько пространственно разделенных случаев суперраспространения, мы ожидаем увидеть высокую длину корреляции, но низкую силу корреляции, потому что все районы с низким числом инфекций имеют высокую корреляцию на большой территории (левая панель на рис. S1). Но если событие суперраспространения вызовет распространение инфекции на соседние районы и будет построена карта числа случаев на районном уровне, эта карта будет выглядеть очень неоднородной, с кластерами с высоким числом случаев рядом с кластерами с низким числом случаев (справа). панель на S1 рис.). Это будет отражено в вариограмме с более короткими длинами корреляции и более высокой силой корреляции. Вариограмма рассчитывается путем вычисления попарных расстояний между всеми точками данных z ( x i ) (в данном случае количество лиц с положительным результатом тестирования в центре тяжести x i района, в котором они зарегистрированы). В зависимости от этих парных расстояний ‖ x I x J ‖, значения сгруппированы в мусорные ведра различных расстояний R с R 9 7 K . . . . . . . . . . i x j ‖< r k +1 — это k -й бин. Теперь мы определяем N ( r k ) как набор всех парных точек данных, которые сгруппированы в k -й бин. Суммируя квадраты разностей всех пар для каждого бина, теперь можно рассчитать вариограмму по следующему уравнению [23, 24].

γ(rk)=12|N(rk)|∑i,j∈N(rk)(z(xi)-z(xj))2

(8)

Вариограммы рассчитываются и оцениваются с помощью GSTools [25]. Для расчета вариограмм зарегистрированные случаи в каждом районе накапливаются за периоды времени всех НКО отдельно. Это дает общее количество зарегистрированных случаев в округе для каждого периода НПИ. Затем рассчитывается эмпирическая вариограмма и к ней подгоняется модель вариограммы для каждого из этих периодов. Для всех эмпирических вариограмм наилучшее соответствие было достигнуто при использовании экспоненциальной модели вариограммы.

γe(r)=σ2(1-exp(-r/λ))

(9)

где σ 2 — сила корреляции или просто дисперсия, а λ — длина корреляции (см. пример на нижней панели S1 Fig). Другой и часто используемой шкалой длины является процентильная шкала, которая определяется как расстояние, на котором достигается определенный процент от максимального значения вариограммы (дисперсии поля).

Визуализация совокупных зарегистрированных случаев на примере периода от второго НПИ 02.04.2020 до третьего НПИ 20.04.2020 на национальном уровне, уровне штата и района показывает, что зарегистрированные случаи распределены очень неоднородно. На уровне штатов можно увидеть градиент с юга на север, но то, что большинство случаев регистрируется только в относительно небольших районах, можно увидеть только на районном уровне. Эти три шкалы открывают возможность сравнения эпидемии в группах населения самого разного размера. Районы имеют типичную численность населения порядка 10 9 человек.0124 5 , штаты 10 7 и нация 10 8 .

Открыть в отдельном окне

Совокупность зарегистрированных случаев COVID-19 на разных иерархических уровнях.

Количество лабораторно подтвержденных случаев COVID-19 на 100 000 человек, накопленное со второго НПИ 02.04.2020 до третьего НПИ 20.04.2020 в трех разных пространственных разрешениях в соответствии с иерархическим административным делением Германии. Границы переизданы из [32] по лицензии CC BY, с разрешения GeoBasis-DE / BKG, оригинальное авторское право 2019 г.. © ГеоБазис-ДЕ/БКГ (2021).

Агрегированные и откалиброванные на национальном уровне подходы сравниваются со случаями положительного тестирования по всей Германии с течением времени (). Во-первых, можно видеть, что откалиброванная национальная модель SEIRD (1)–(5) с переменной частотой контактов может быть использована для воспроизведения эпидемии в Германии. Агрегирование результатов моделирования с помощью подобранных моделей районов также воспроизводит количество случаев на национальном уровне, но с некоторыми интересными отклонениями от подобранной национальной модели. Оба подхода хорошо сочетаются с очень быстрым ростом числа зарегистрированных случаев до середины марта. Последующий пик недооценивается агрегированными моделями. В начале апреля они показывают второй пик, которого нет в национальной модели. При более низких показателях заражения накопленные модели работают хорошо, хотя они имеют тенденцию показывать небольшие пики в точках изменения NPI. Начиная с окончательного NPI, события распространения становятся более разбросанными с более высокой дисперсией, а агрегированные модели недооценивают количество случаев. Существует проблема с начальными условиями, поскольку на ранней стадии эпидемии во многих районах не было зарегистрированных случаев или были более длительные периоды с нулевым уровнем инфицирования. Поэтому случаи должны быть интегрированы в течение нескольких дней для нетривиальных начальных условий. Это приводит к тому, что агрегированные случаи становятся больше в начале моделирования.

Открыть в отдельном окне

Сравнение результатов подобранной модели на разных иерархических уровнях.

Сравнение параметризованной модели, выполняемой на более высоком иерархическом уровне, с агрегированными номерами случаев из подобранных моделей районного уровня. Подогнанная национальная модель и суммированные положительные случаи, полученные на основе 412 моделей районного уровня, сравниваются с общенациональными зарегистрированными случаями на левой панели и подобранной государственной моделью Баварии и суммированными положительными случаями, полученными в результате ее 96 моделей районного уровня сравниваются с зарегистрированными случаями в Баварии на правой панели. Заштрихованная область указывает на 95% достоверный интервал. Вертикальные серые линии указывают даты НФУ.

Точно так же и очень легко в рамках этой модели моделирования данные районного уровня могут быть агрегированы на следующий иерархический уровень, а именно на штаты. В качестве примера взята земля Бавария, в которой было больше всего заболевших из всех германских государств во время первой волны. Результат аналогичен сравнению национальной модели. Совокупные зарегистрированные случаи показывают два пика, тогда как модель состояния показывает только один поздний пик. Пики в даты NPI также присутствуют, и агрегированные модели недооценивают медленное и разрозненное увеличение с августа.

Теперь, когда мы увидели, что агрегированные подходящие симуляции могут воспроизводить зарегистрированные номера случаев на более высоких иерархических уровнях, мы можем проанализировать отдельные районы и посмотреть, что усредняется, глядя на номера случаев на более высоком иерархическом уровне. В то же время показаны возможности и ограничения модифицированной модели SEIRD (1)–(5) применительно к районам. Здесь обсуждаются результаты параметризованного моделирования для трех районов с качественно разным течением эпидемии. Теперь представлены результаты модельных прогонов, адаптированных к Stadtkreis (SK, городской округ) Jena, Landkreis (LK, сельский округ) Gütersloh и SK Duisburg соответственно (). αE. Вертикальные серые линии указывают даты НФУ.

SK Jena был первым районом, где было введено обязательное ношение масок, и в то же время этому району очень удалось быстро сократить количество подтвержденных случаев почти до нуля: всего за несколько дней за несколько месяцев были подтверждены единичные новые случаи. Это снижение может быть прямым следствием обязательного ношения масок [7]. Снижение числа случаев также видно из результатов подобранной модели, где пик новых зарегистрированных случаев пришелся на время, когда была внедрена первая НПВ. После этого пика скорость быстро снизилась примерно до нуля в день во время третьего NPI. Постепенное увеличение неопределенности в контактных ставках с β 2 до β 6 ​​ является результатом очень низкого числа случаев ().

Открыть в отдельном окне

Апостериорные распределения параметров для СК Йена.

Апостериорные распределения параметров для СК Йена. Для лучшей наглядности параметры κ и μ снова показаны в отдельной шкале y. Внутри скрипок показана классическая блочная диаграмма с белой точкой, указывающей оптимальный параметр.

По сравнению с Йеной, в ЛК Гютерсло пик заболеваемости в начале эпидемии был более широким, но ко времени проведения третьего НПИ уровень заболеваемости и здесь стал очень низким. Ситуация изменилась в середине июня, когда на мясоперерабатывающем заводе произошла крупная вспышка, в которой заразилось более 1000 сотрудников [8, 9]. Эта вспышка распространилась на ЛК Гютерсло и ЛК Варендорф, где проживало много сотрудников. Эта вспышка длилась около двух недель, но модель расширяет и расширяет пик между точками изменения NPI до и после события. Это проблема недостаточного временного разрешения частот контактов β j . Недостаток текущей оценки параметров выявляется результатами модели для Гютерсло. Оценка всех коэффициентов контактов β j производится одновременно, а не для каждого периода НФУ последовательно. Эта проблема возникает перед пятым НПИ, когда число экспонированных и заразных лиц увеличивается только для того, чтобы уменьшиться после НПИ, чтобы лучше соответствовать данным.

SK Duisburg имеет средний уровень инфицирования I¯obs=14d-1±8d-1 со стандартным отклонением 58% без значимой тенденции. Линейная аппроксимация данных приводит к наклону только dI¯obsdt=0,016d−2. Хотя модели типа SIR имеют тенденцию либо к экспоненциальному увеличению, либо к уменьшению скоростей, модифицированная модель SEIRD (1)–(5) удовлетворительно воспроизводит линейный тренд в Дуйсбурге. Высокая дисперсия зарегистрированных случаев влияет на 95% доверительный интервал, где разброс намного выше по сравнению с двумя другими анализируемыми районами.

Мы провели G-тесты [26] для оценки соответствия всех моделей. За исключением районов, где уровни инфицирования измеряются однозначным числом с интервалом до нескольких недель, например LK Altmarkkreis Salzwedel, все модели воспроизводят наблюдаемые уровни инфицирования и смертности с высокой вероятностью ( p < 0,05).

По-иному взглянуть на ход эпидемии можно, взглянув на вариограммы заболеваемости. Вариограмма и ее соответствие для одного периода NPI с 17 марта 2020 г. по 23 марта 2020 г. совокупных показателей заболеваемости показаны на рис. Вариограммы для всех периодов можно найти в приложении (рис. S2.3 в файле S1). Корреляционные длины, полученные из вариограмм, увеличиваются примерно с λ 1 = 40 км и пик на гребне первой волны на удвоенной длине λ 2 = 81 км, когда были реализованы первые НФУ (). С этого момента корреляционные длины падают до тех пор, пока первые NPI не ослабнут 20 апреля 2020 г. с λ 4 = 26 км, где корреляционные длины остаются почти постоянными до небольшого пика при λ 6 ​​ = 36 км. . Наконец, глобальный минимум λ 7 = 5,8 км достигается при последней релаксации NPI. Для сравнения, среднее расстояние районных центроидов до соседних районных центроидов составляет около 32 км.

Открыть в отдельном окне

Результаты анализа вариограммы.

На левой панели показаны эмпирическая и экспоненциальная вариограммы (9) кумулятивной частоты зарегистрированных случаев за период времени до первого NPI. Эволюция во времени корреляционных длин λ i ковариационных моделей для кумулятивных случаев показана на правой панели. Среднее расстояние до центроидов соседних районов показано пунктирной серой линией.

В этой работе мы представляем модифицированную эпидемиологическую модель типа SEIRD с переменной частотой контактов, адаптированную к пандемии COVID-19. Эта модель соответствует данным по каждому из 412 немецких округов, всех 16 штатов и страны. Параметризация выполняется с использованием данных RKI о ежедневных положительных тестах и ​​смертях, связанных с COVID-19. Самый важный на сегодняшний день инструмент регулирования эпидемии, немедикаментозные вмешательства, реализуются с использованием кусочно-постоянных коэффициентов контактов, которые меняются только в даты реализации НПИ. Эта модель достаточно гибкая, чтобы удовлетворительно воспроизвести временную эволюцию эпидемии на районном уровне в течение многих месяцев, хотя развитие эпидемии качественно сильно различается в разных районах. В некоторых районах наблюдался ярко выраженный первый пик, за которым последовал длительный период, в течение которого болезнь была практически ликвидирована. У других был более или менее постоянный уровень положительно протестированных случаев в течение нескольких месяцев. Кроме того, одна и та же модель может воспроизводить эпидемию на уровне штата и на национальном уровне. Однако только на районном уровне пространственное разрешение достаточно высокое для анализа пространственных закономерностей, для чего мы используем геостатистический метод оценки вариограмм. Этот метод не требует никаких дополнительных данных, что делает анализ вариограмм идеальным инструментом в начале новых эпидемий, когда доступны лишь ограниченные данные.

Мониторинг и моделирование инфекций на этом мелкомасштабном уровне — это первый шаг к созданию локальных, точных и целевых НПИ. Это могло бы повысить соотношение затрат и выгод, а также признание НФУ. Длины корреляции рассчитанных вариограмм могут помочь в оценке того, достаточно ли местных NPI или следует ли проводить измерения штата или даже всей страны. Ниже приводится пример сценария, когда одних только показателей заболеваемости или еженедельных показателей заболеваемости недостаточно для оценки эффективности НФВ местного масштаба. Если карантин после события суперраспространения будет применен слишком поздно или недостаточно строго, это может уменьшить общее количество новых зарегистрированных случаев, но жители пригородных поездов, возможно, уже распространили болезнь на соседние районы. В этих близлежащих районах число случаев заболевания будет только медленно увеличиваться. Таким образом, принимая во внимание только общее количество случаев, можно прийти к выводу, что событие суперраспространения было успешно помещено в карантин. Принимая во внимание, что длина корреляции будет увеличиваться на раннем этапе с медленным распространением на соседние районы, даже несмотря на то, что общее количество зарегистрированных случаев снижается после первоначального карантина. Эту информацию также можно извлечь из карт, но они содержат информацию сложным образом, и всегда легче передавать информацию в отдельных числах (например, еженедельные показатели заболеваемости вместо динамики зарегистрированных случаев во времени, среднее значение вместо полного раздача, ч -указатель вместо качества и тематики исследователя).

Высокое пространственное разрешение районного уровня открывает возможность агрегирования результатов до определенного уровня, т.е. на уровне штатов или на национальном уровне, что также может дать уникальное представление об эпидемии. Агрегированные районные модели показывают второй пик во время первой волны 01.04.2020 (). На самом деле это может указывать на большое количество районов, где пик заражения был достигнут с опозданием примерно на две недели по сравнению с районами, в которых эпидемия началась раньше. На национальном уровне эта задержка полностью усреднена, и ее нельзя увидеть в данных общегерманского уровня. Позже агрегированные районные модели, как правило, недооценивают количество случаев на национальном уровне. Причиной этого может быть то, что динамика эпидемии часто определяется локальными событиями суперраспространения, которые можно было бы эффективно изолировать и поместить в карантин. Эти события выглядят как выбросы на районном уровне, но увеличивают усредненные случаи на национальном уровне, что облегчает их сопоставление на более высоком уровне. С августа инфекции становятся более рассеянными с гораздо более высокой изменчивостью, чем раньше. Это также примерно то время, когда было реализовано больше местных НФУ, и подход к централизованному моделированию с фиксированными НФУ для всех районов мог стать слишком жестким для такого сценария.

Длины корреляции λ i , полученные из оценки вариограммы, подтверждают идею о том, что районы представляют собой подходящий уровень детализации для мониторинга и моделирования эпидемии. Тот факт, что экспоненциальные вариограммы лучше всего соответствуют данным, также подтверждает это, поскольку это относительно грубый тип корреляции по сравнению, например, с вариограммами. Гауссовы вариограммы, указывающие на то, что, хотя существуют ярко выраженные пространственные корреляции, в непосредственно соседних районах все же может быть очень разное количество случаев. Если λ i меньше, чем среднее расстояние до соседнего района, это указывает на то, что НКО следует внедрять только на местном районном уровне, согласно, например, еженедельные показатели заболеваемости района, публикуемые RKI. Однако, если λ i больше, чем межрайонное расстояние, и меньше, чем среднее расстояние между соседними штатами, предполагается, что НКО следует применять на государственном или промежуточном уровне, т.е. в Regierungsbezirken (провинциях) в Германии. Если кластеры вырастут за пределы штата, общенациональные НКО, вероятно, снова окажутся подходящими. Этот иерархический подход к управлению работает в обоих направлениях, не только для применения новых НФУ в целевых пространственных масштабах, но и для повышения эффективности существующих в разных регионах по мере ослабления эпидемии. Эта структура моделирования также позволяет очень легко делать прогнозы на разных иерархических уровнях, например. какое влияние окажут НФВ на еженедельные показатели заболеваемости, если они будут применяться локально на районном уровне или если они будут применяться на уровне штата. Сочетание этого с экономической моделью может помочь найти баланс между эффективностью и затратами НКО. Следует иметь в виду, что количество случаев, по которым мы калибруем модель, скорее всего, будет занижено. Сероэпидемиологическое исследование в четырех особо пострадавших районах Германии выявило от 1,6 до 6 раз больше инфекций, чем официально сообщалось [27]. Как следствие, отчеты являются нижней границей фактического числа новых зараженных. Тем не менее, эта нижняя граница все еще может использоваться в качестве прокси для будущих потребностей отделений интенсивной терапии [6]. Однако, если стратегии тестирования существенно не меняются, нет оснований полагать, что относительные изменения в фактических случаях заражения не сильно коррелируют с зарегистрированными. Следовательно, последствия НФВ можно оценить, поскольку они влияют на производную по времени зарегистрированных случаев и, следовательно, на относительное изменение. Показатели смертности кажутся более надежными, и даже предполагалось, что они являются лучшим показателем для сравнения пандемии в разных странах, чем уровни заражения [28].

Результаты модели, вероятно, улучшатся, если периоды NPI будут параметризованы индивидуально и последовательно. Это предотвратило бы увеличение моделью числа случаев до NPI и фактического увеличения, как видно из результатов для LK Gütersloh на 09 июня 2020 г. () или в пиках на даты NPI в агрегированных моделях. (). Однако существует множество подходов для такой последовательной параметризации. Подход, представленный в этом исследовании, мог быть предшественником, из которого все постоянные параметры ( α , γ , κ , μ ). Впоследствии частоты контактов β j можно последовательно параметризовать, рассматривая один период NPI за раз и с априорными значениями для β j , взятыми из прогона предшественников. В качестве альтернативы, постоянные параметры также могут быть оценены для каждого периода NPI отдельно. Различия в этих предположительно постоянных параметрах можно было бы использовать в качестве индикатора, позволяющего увидеть, следует ли в дальнейшем разделить компартменты на разные возрастные группы, поскольку эти параметры различаются между разными возрастными группами. Но изучение этих возможностей выходит за рамки данной работы.

Дальнейшим и, вероятно, более важным улучшением может быть выбор подходящего алгоритма из множества опубликованных алгоритмов обнаружения выбросов [29] и применение его к временным рядам RKI для автоматической идентификации событий сверхрасширения. Затем такое событие можно было бы внедрить в существующую структуру моделирования с помощью дополнительного члена переноса, который действует как исходный член импульсного типа Дирака для отсека Infectious , но в то же время подчиняется законам сохранения. Таким образом, местные НФУ могут быть обнаружены и применены автоматически без необходимости вручную назначать НФУ всем районам в отдельности.

Альтернативный подход может состоять в том, чтобы получить информацию о событиях с суперраспространителями путем определения точек изменения частоты контактов, как это сделано Dehning et al. [30]. Модели типа

SEIRD используются для прогнозирования или моделирования сценариев [6, 31]. Таким образом, оценка прогностических возможностей модифицированной модели SEIRD (1)–(5) является будущим направлением нашей работы. Это может быть объединено с обнаружением выбросов, чтобы автоматически поднимать флаг в случае внезапного увеличения числа новых зарегистрированных случаев за последние несколько дней.

S1 Fig

Два примера пространственных случайных полей и их вариограмм.

Границы переиздано из [32] по лицензии CC BY, с разрешения GeoBasis-DE / BKG, оригинальные авторские права 2019. © GeoBasis-DE / BKG (2021).

(PNG)

Щелкните здесь, чтобы просмотреть файл с дополнительными данными. (428K, png)

Файл S1

Оценка модели.

(PDF)

Щелкните здесь, чтобы просмотреть файл с дополнительными данными. (729K, pdf)

Эта работа была частично профинансирована Центром изучения передовых систем (CASUS), который финансируется Федеральным министерством образования и исследований Германии (BMBF) и Министерством науки, культуры и туризма Саксонии (SMWK). с налоговыми фондами на основе бюджета, утвержденного саксонским земельным парламентом. Эта работа также частично финансировалась проектом Where2Test, который SMWK финансирует из налоговых средств на основе бюджета, утвержденного Саксонским земельным парламентом (номер гранта 100525661).

Все данные, используемые в этой работе, находятся в свободном доступе от Института Роберта Коха (https://www.rki.de/EN/Home/homepage_node.html) и Федерального статистического управления Германии (https://www.destatis). .de/DE/Themen/Laender-Regionen/Regionales/Gemeindeverzeichnis/Administrativ/04-kreise.html).

1. Кучинотта Д. , Ванелли М. ВОЗ объявляет COVID-19 пандемией;91(1):157–160. doi: 10.23750/abm.v91i1.9397 [бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

2. Ferguson N, Laydon D, Nedjati Gilani G, Imai N, Ainslie K, Baguelin M, et al. Отчет 9: Влияние немедикаментозных вмешательств (НФВ) на снижение смертности от COVID-19 и потребности в медицинской помощи; Доступно по адресу: http://spiral.imperial.ac.uk/handle/10044/1/77482.

3. Khailaie S, Mitra T, Bandyopadhyay A, Schips M, Mascheroni P, Vanella P, et al. введите [;]Доступно по адресу: http://medrxiv.org/lookup/doi/10.1101/2020.04.04.20053637.

4. Никола М., Алсафи З., Сохраби С., Керван А., Аль-Джабир А., Иосифидис С. и соавт. Социально-экономические последствия пандемии коронавируса (COVID-19): Обзор; 78: 185–193. doi: 10.1016/j.ijsu.2020.04.018 [бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

5. Statistisches Bundesamt [Destatis];. Доступно по адресу: https://www.destatis.de/EN/Themes/Economy/National-Accounts-Domestic-Product/Tables/gdp-bubbles. html.

6. Барбаросса М.В., Фурманн Дж., Мейнке Дж.Х., Криг С., Варма Х.В., Кастеллетти Н. и соавт. Моделирование распространения COVID-19 в Германии: ранняя оценка и возможные сценарии;15(9):e0238559. doi: 10.1371/journal.pone.0238559[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

7. Mitze T, Kosfeld R, Rode J, Wälde K. Маски для лица значительно снижают заболеваемость COVID-19 в Германии: метод синтетического контроля; п. 31. [Бесплатная статья PMC] [PubMed] [Google Scholar]

8. Guenther T, Czech-Sioli M, Indenbirken D, Robitailles A, Tenhaken P, Exner M, et al. Расследование события сверхраспространения, предшествовавшего крупнейшей вспышке SARS-Coronavirus 2 на мясоперерабатывающих предприятиях в Германии; дои: 10.2139/ssrn.3654517 [CrossRef] [Google Scholar]

9. RKI — Домашняя страница;. Доступно по адресу: https://www.rki.de/EN/Home/homepage_node.html.

10. Kergaßner A, Burkhardt C, Lippold D, Kergaßner M, Pflug L, Budday D, et al. Мезомасштабное моделирование Covid-19 на основе памяти: временные рамки с разрешением округов в Германии; 66 (5): 1069–1079. дои: 10.1007/s00466-020-01883-5 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

11. Kapoor A, Ben X, Liu L, Perozzi B, Barnes M, Blais M, et al. Изучение COVID-19Прогнозирование с использованием пространственно-временных графовых нейронных сетей.

12. Ван Л., Сюй Т., Стокер Т.Х., Стокер Х., Цзян Ю., Чжоу К. Пространственно-временная эпидемиологическая модель машинного обучения для оценки риска COVID-19 на уровне округа Германии.

13. Statistisches Bundesamt [Destatis];. Доступно по адресу: https://www.destatis.de/DE/Themen/Laender-Regionen/Regionales/Gemeindeverzeichnis/Administrativ/04-kreise.html.

14. Kermack WO, McKendrick AG. Вклад в математическую теорию эпидемий; 115 (772): 700–721. [Академия Google]

15. Diekmann O, Heesterbeek JAP, Roberts MG. Построение матриц следующего поколения для моделей эпидемий с разбивкой по частям;7(47):873–885. doi: 10.1098/rsif.2009.0386 [бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

16. Dormand JR, Prince PJ. Семейство встроенных формул Рунге-Кутты; 6(1):19–26. doi: 10.1016/0771-050X(80)

  • -3 [CrossRef] [Google Scholar]

    17. SciPy 10 Contributors, Virtanen P, Gommers R, Oliphant TE, Haberland M, Reddy T, et al. SciPy 1.0: фундаментальные алгоритмы научных вычислений на Python; 17(3):261–272. дои: 10.1038/s41592-019-0686-2 [бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

    18. Метрополис Н., Розенблут А.В., Розенблут М.Н., Теллер А.Х., Теллер Э. Уравнение состояний вычислений с помощью быстрых вычислительных машин; 21(6):1087–1092. doi: 10.1063/1.1699114 [CrossRef] [Google Scholar]

    19. Hastings WK. Методы выборки Монте-Карло с использованием цепей Маркова и их приложения;57(1):97–109. [Google Scholar]

    20. Хоуска Т., Крафт П., Чаморро-Чавес А., Брейер Л. Определение параметров модели с помощью готового пакета Python; 10(12):e0145180. doi: 10.1371/journal.pone.0145180 [бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

    21. Шнике Т., Лангенберг Б., Шрамм Г., Краузе К., Стремпель Т. EVE — Высокопроизводительный вычислительный кластер.

    22. Салтелли А., Тарантола С., Чан К.П.С. Количественный независимый от модели метод анализа глобальной чувствительности выходных данных модели; 41(1):39–56. doi: 10.1080/00401706.1999.10485594 [CrossRef] [Google Scholar]

    23. Матерон Г. Принципы геостатистики;58(8):1246–1266. doi: 10.2113/gsecongeo.58.8.1246 [CrossRef] [Google Scholar]

    24. Рубин Ю. Прикладная стохастическая гидрогеология. Издательство Оксфордского университета;. [Академия Google]

    25. Шулер Л., Мюллер С. GeoStat-Framework / GSTools: Volatile Violet v1.2.1;. Доступно по адресу: https://zenodo.org/record/3751743.

    26. Сокаль Р.Р., Рольф Ф.Й. Биометрия: принципы и практика статистики в биологических исследованиях. 3-е изд. В.Х. Фримен;. [Google Scholar]

    27. Сантос-Ховенер С., Буш М.А., Кошоллек С., Шлауд М., Хобель Дж., Хоффманн Р. и др. Сероэпидемиологическое исследование распространения SARS-CoV-2 среди населения в особо пострадавших районах Германии — протокол локального исследования CORONA-MONITORING;.

    28. Лау Х., Хосравипур Т., Кокбах П., Ичии Х., Баниа Дж., Хосравипур В. Оценка массового занижения сведений и недооценки случаев COVID-19 в нескольких глобальных эпицентрах; 27(2):110–115. doi: 10.1016/j.pulmoe.2020.05.015 [бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

    29. Ходж В.Дж., Остин Дж. Обзор методологий обнаружения выбросов; 22:85–126. doi: 10.1023/B:AIRE.0000045502.10941.a9 [CrossRef] [Google Scholar]

    30. Dehning J, Zierenberg J, Spitzner FP, Wibral M, Neto JP, Wilczek M, et al. введите [;]Доступно по адресу: http://medrxiv.org/lookup/doi/10.1101/2020.04.02.20050922.

    31. Maier BF, Brockmann D. Эффективное сдерживание объясняет субэкспоненциальный рост числа недавних подтвержденных случаев COVID-19 в Китае; п. еабб4557. doi: 10.1126/science.abb4557 [бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

    32. GeoBasis-DE / BKG 2019;. Доступно по адресу: https://gdz.bkg.bund.de/index.php/default/open-data/verwaltungsgebiete-1-250-000-ebenen-stand-31-12-vg250-ebenen-31-12.html. .


    Статьи из PLoS ONE предоставлены Public Library of Science


    Пемфигоид беременных, осложняющий беременность при донорстве яйцеклеток | HTML

    Liliana Guerra1, Cinzia Mazzanti2, Valentina Calabresi1, Naomi De Luca1, Giovanna Zambruno1 и Giovanni Di Zenzo1

    1Laboratory of Molecular and Cell Biology and 21st Dermatology Division, Istituto Dermopatico dell’Immacolata-IRCCS, via dei 1 Monti 4 di IT-00167 Рим, Италия. Электронная почта: [email protected]

    Принято 24 ноября 2015 г.; Epub перед печатью 26 ноября 2015 г.

    Пемфигоид беременных (ПГ) — редкое аутоиммунное пузырчатое заболевание, наиболее часто встречающееся во втором или третьем триместре беременности (1, 2). ПГ проявляется либо у первородящих, либо у повторнородящих женщин с тенденцией к более ранним и тяжелым рецидивам при последующих беременностях (2, 3). Кожные проявления обычно начинаются в околопупочной области (1), улучшаются перед родами и снова ухудшаются во время родов (4, 5). Основным антигеном-мишенью при ПГ является антиген буллезного пемфигоида с молекулярной массой 180 кДа (BP180 или коллаген XVII), трансмембранный гемидесмосомальный гликопротеин, экспрессируемый в зоне базальной мембраны (BMZ) кожи (1, 5). Экспрессия BP180 в плацентарном и амниотическом эпителиях (6) свидетельствует о том, что материнские проявления ПГ могут быть результатом перекрестной реакции между плацентарными и кожными антигенами.

    Микроскопически наличие субэпидермальной буллы с выраженным эозинофильным инфильтратом свидетельствует о ПГ (7). Прямая иммунофлуоресцентная микроскопия (DIF) остается золотым стандартом диагностики. Действительно, диагностическим признаком ПГ является линейное отложение C3 вдоль BMZ (1). Иммуноферментный анализ BP180 (ELISA) является высокочувствительным тестом на PG и может использоваться для корреляции титра антител с тяжестью заболевания даже в доклинических условиях (1, 8, 9).

    Мы сообщаем здесь о редком случае PG, возникшем у женщины, беременность которой была достигнута с помощью донорской яйцеклетки (ED), следовательно, вынашивание плода с полностью аллогенным геномом.

    Клинический случай

    38-летняя женщина на 36-й неделе гестации поступила в нашу клинику с острым началом зудящих уртикарных высыпаний в околопупочной области, за которыми последовали волдыри, распространившиеся на туловище и конечности в несколько дней. Физикальное обследование выявило эритематозные, похожие на крапивницу бляшки, окружающие пупок и разбросанные по животу, связанные с везикулами и буллами (рис. 1а). Многочисленные поражения также присутствовали на ягодицах и стопах (рис. 1б). Слизистые оболочки не были вовлечены.

    У пациентки было бесплодие из-за первичной недостаточности яичников, беременность наступила в результате экстракорпорального оплодотворения донорской яйцеклетки спермой мужа с последующим переносом эмбриона.

    Предыдущая неосложненная беременность наступила 3 ​​года назад с использованием того же метода вспомогательной репродукции, с той лишь разницей, что был использован донор ооцитов.

    Перед обеими беременностями пациентка лечилась пероральной терапией эстрогеном, чтобы вызвать регулярные менструации. В I триместре каждой беременности пероральную гормональную терапию заменяли на местную гестагенную терапию, которая затем прерывалась. Пациентка не сообщала о каких-либо других предшествующих дерматозах, и ее предыдущая история болезни была ничем не примечательна. Общий анализ крови, общепринятые биохимические анализы и анализ мочи были в пределах нормы.

    Гистопатологическое исследование эритематозной бляшки на туловище показало гиперпластический эпидермис и дермальный, преимущественно периваскулярный, инфильтрат из лимфоцитов с редкими эозинофилами. DIF-микроскопия кожи вокруг поражений выявила непрерывные линейные отложения С3 (рис. 1с) и иммуноглобулина G (IgG) вдоль BMZ. Непрямая иммунофлуоресцентная микроскопия продемонстрировала связывание IgG из сыворотки пациента с BMZ нормальной кожи человека (рис. 1d) и окрашивание эпидермальной стороны расщепленной солью кожи (рис. 1e). ELISA на основе BP180 (MBL, Нака-ку, Нагоя, Япония) дал положительный результат (48,6 ЕД/мл; нормальное значение <9).Ед/мл), в то время как ИФА на антиген буллезного пемфигоида (MBL) 230 кДа был отрицательным.

     

    Рис. 1. (а) Околопупочные пузырьки и буллы на эритематозном основании. (б) Эритема и плотные серозные волдыри на правой стопе. ( c ) Сильное линейное отложение C3 вдоль зоны базальной мембраны кожи с помощью прямой иммунофлуоресценции (IF). ( d ) Циркулирующие антитела IgG против базальной мембраны кожи (стрелки), обнаруженные в сыворотке пациента с помощью непрямого IF. (e) Линейное окрашивание вдоль крыши разреза (стрелки) с помощью непрямого IF на коже человека, расколотой солью. Бары: 50 мкм (с) и 25 мкм (г и д). Исходное увеличение × 20 (в–д).

     

    Был поставлен диагноз ПГ, и пациентка лечилась пероральным преднизолоном в дозе 0,5 мг/кг/сут в течение одной недели с быстрым улучшением поражений ПГ. Затем пероральная стероидная терапия была постепенно снижена. На 38-й неделе гестации пациентке было проведено плановое кесарево сечение, в результате чего родился ребенок мужского пола весом 3400 г без кожных поражений. Через 15 дней после родов у пациентки развился рецидив очагов ПГ, и терапия преднизоном была возобновлена ​​до полной ремиссии симптомов. С тех пор у пациента больше не было рецидивов ПГ.

    ОБСУЖДЕНИЕ

    Описанный здесь случай является первым сообщением о ПГ после ЭД у повторнородящей женщины, у которой не было никаких осложнений во время предыдущей беременности с ЭД. Развитие PG при спонтанно зачатой ​​(SC) беременности коррелирует с материнскими молекулами главного комплекса гистосовместимости (MHC) класса II, в частности с человеческими лейкоцитарными антигенами (HLA) -DR3 и -DR4 (10). Также сообщалось об ассоциации с отцовским HLA-DR2 (10). Улучшение симптомов ПГ до родов и рецидив во время родов также побудили исследователей связать естественное течение ПГ с прогестероном, обладающим иммуносупрессивными свойствами, и с повышением уровня прогестерона на поздних сроках беременности с последующим снижением во время беременности. доставка (1). Однако точный патогенетический механизм ПГ остается в значительной степени неизвестным.

    При SC беременности ткани плаценты и плода содержат отцовские антигены, чужеродные для иммунной системы матери (1). Таким образом, полуаллогенный плод избегает иммунного отторжения матери и индуцирует толерантность, создавая иммунно-привилегированный участок на границе между плодом и матерью (11-13). Тем не менее подавление материнского иммунного ответа против полностью аллогенного плода включает более сложные и, возможно, другие механизмы, чем при СК при беременности полуаллогенным плодом (12). Действительно, беременные с ЭД гораздо чаще имеют более высокую степень несоответствия HLA и антигенного несходства между беременными женщинами и их детьми по сравнению с беременностями с SC (рис. S11) (11, 12). Было продемонстрировано, что успешная беременность с ЭД характеризуется повышенным количеством активированных (CD4+CD25dim) и регуляторных (CD4+CD25bright) Т-лимфоцитов, причем последние участвуют в регуляции периферической иммунной системы матери (13). Эти результаты сочетаются с более сильным подавлением аллоиммунного ответа в материнской крови при ЭД по сравнению с беременностями с SC (13). Эти защитные механизмы могут поддерживать и укреплять иммуносупрессивную среду в беременной матке, таким образом обеспечивая выживание полностью аллогенного плода. Тем не менее, более высокий риск плацентарных осложнений, в частности преэклампсии и гестационной гипертензии, был зарегистрирован при ЭД беременных (12, 14) и предположительно связан с иммунологической непереносимостью между матерью и плодом.

    Относительно ПГ во время ЭД во время беременности имеется только одно предыдущее литературное сообщение у первородящей женщины (15). Вполне вероятно, что более широкое использование технологий вспомогательной репродукции, включая ЭД, приведет к ответу на вопрос, может ли ЭД влиять на развитие ПГ.

    Благодарности

    Авторы выражают благодарность Министерству здравоохранения Италии (Ricerca Corrente 2013–2015, GDZ).

    1 http://www.medicaljournals.se/acta/content/?doi=10.2340/00015555-2303

     

    ССЫЛКИ

    1. Huilaja L, Makikallio K, Tasanen K. Гестационный пемфигоид. Orphanet J Rare Dis 2014; 9: 136.

    2. Нуара А.А., Обадия Дж.М., Херли М.Ю. Пемфигоид беременных: кожные проявления нарушения переносимости плода аллотрансплантата. Скинмед 2010; 8: 121–123.

    3. Тани Н., Кимура Ю., Кога Х., Каваками Т., Охата С., Исии Н. и др. Клинико-иммунологический профиль 25 пациенток с пемфигоидом беременных. Бр Дж Дерматол 2015; 172: 120–199.

    4. Дженкинс Р.Э., Херн С., Блэк М.М. Клинические особенности и ведение 87 пациенток с пемфигоидом беременных. Clin Exp Dermatol 1999; 24: 255–259.

    5. Семкова К., Блэк М. Пемфигоид беременных: современный взгляд на патогенез и лечение. Eur J Obstet Gynecol Reprod Biol 2009; 145: 138–144.

    6. Huilaja L, Hurskainen T, Autio-Harmainen H, Hofmann SC, Sormunen R, Rasanen J, et al. Пемфигоид беременных является аутоантигеном, трансмембранным коллагеном XVII, способствует миграции цитотрофобластических клеток плаценты и является структурным компонентом плодных оболочек. Матрица Биол 2008; 27:190–200.

    7. Интонг Л.Р., Мюррелл Д.Ф. Пемфигоид беременных: патогенез и клиника. Дерматол Клин 2011; 29: 447–452.

    8. Huilaja L, Surcel HM, Bloigu A, Tasanen K. Повышенный уровень антител BP180 в сыворотке крови в первом триместре беременности предшествует гестационному пемфигоиду и остается повышенным в течение длительного времени после ремиссии заболевания. Акта Дерм Венереол 2015; 95: 843–844.

    9. Di Zenzo G, Calabresi V, Grosso F, Caproni M, Ruffelli M, Zambruno G. Внутриклеточные и внеклеточные домены антигена BP180 содержат новые эпитопы, на которые нацелены аутоантитела к пемфигоиду беременности. Дж Инвест Дерматол 2007; 127: 864–873.

    10. Шиманович И. , Брокер Э.Б., Цилликенс Д. Пемфигоид беременных: новое понимание патогенеза ведет к новым диагностическим инструментам. БЖОГ 2002; 109: 970–976.

    11. Лэшли Л.Э., ван дер Хорн М.Л., Хааснут Г.В., Роелен Д.Л., Клаас Ф.Х. Неосложненная беременность при донорстве ооцитов связана с более высокой частотой выявления аллоантител к человеческому лейкоцитарному антигену. Хум Иммунол 2014; 75: 555–560.

    12. Ван дер Хорн М.Л., Лэшли Э.Е., Бьянки Д.В., Клаас Ф.Х., Шонкерен К.М., Шерджон С.А. Клинические и иммунологические аспекты беременности с донорством яйцеклеток: систематический обзор. Обновление Hum Reprod 2010; 16: 704–712.

    13. ван дер Хоорн М.Л., ван Эгмонд А., Свингс Г.М., ван Билен Э., ван дер Кеур С., Тирадо-Гонсалес И. и др. Дифференциальная иммунорегуляция при успешной беременности с донорством ооцитов по сравнению с беременностью, зачатой ​​естественным путем. J Reprod Immunol 2014; 101–102: 96–103.

    14. Леврон Ю., Двири М., Сегол И., Йерушалми Г.М., Хурвиц А. , Орвието Р. и др. Новый взгляд на «иммунологическую теорию» преэклампсии: уроки вынашивания донорских ооцитов. Am J Obstet Gynecol 2014; 211: 383.e1–5.

    15. Пива И., Ло Монте Г., Грациано А., Марси Р. Герпес беременных после оводонации: является ли плацента единственной мишенью иммунной реакции? J Clin Diagn Res 2014; 8: ОД01–2.

    Вспышки высокопатогенного вируса птичьего гриппа подтипов H5N8, H5N5, H5N1, H5N4 и H5N3 в Германии в 2020-21 гг. | Virus Evolution

    Abstract

    С октября 2020 г. по июль 2021 г. было обнаружено пять различных подтипов (H5N8, H5N5, H5N1, H5N4 и H5N3) и семь генотипов высокопатогенных вирусов птичьего гриппа (HPAIV), принадлежащих к кладе 2.3.4.4b. в широком спектре птичьих хозяев в Германии. Первоначальное вторжение диких птиц с беспрецедентным распространением ржанкообразных на побережье Ваттового моря, переносящих только подтип H5N3, боковое распространение между домашними птицами с обнаружением новых реассортантов и смешанных инфекций в птицеводческих хозяйствах, подозрение на возврат HPAIV от домашних птиц к диким птицам и обнаружение ВПЧ-инфицированных диких птиц следующим летом 2021 г. были отличительными чертами этой эпизоотии. С помощью филогенетического анализа были обнаружены локальные события реассортации с низкопатогенными штаммами ВГП, при этом в большинстве случаев доминировал HP H5N8, а позже — штамм HP H5N1. Кроме того, удалось генетически охарактеризовать первый в истории описанный штамм HPAIV подтипа H5N4.

    HPAIV, H5N8, H5N5, H5N1, H5N4, H5N3, рекомбинация, секвенирование третьего поколения, MinION, секвенирование нанопор клады 2.3.4.4b в 2016 г. в Германии произошла целая серия новых вторжений с различными реассортантами (King et al. 2021). Вирусы клады 2.3.4.4b, происходящие из линии гуся/Гуандун (gs/GD), впервые обнаруженные в Китае в 1996 г., продемонстрировали беспрецедентную тенденцию к реассортации, что привело к беспорядочному множеству суб- и генотипов (Xu et al. 1999). После обширной и разнообразной эпизоотии в 2016–2018 годах, которая нанесла серьезный ущерб популяциям диких птиц и сектору птицеводства (Globig et al., 2017; Pohlmann et al. , 2018), новое вторжение другой клады 2.3.4.4b HPAI H5N8 вариант в феврале 2020 г. привел лишь к незначительной вспышке на небольших фермах и птицах, содержащихся в неволе (Swieton et al. 2020; King et al. 2020b). Обнаружение новых вирусов HPAI H5Nx клады 2.3.4.4b в октябре 2020 г. в Германии повлекло за собой крупнейшую зарегистрированную эпизоотию HPAI в стране на сегодняшний день (EFSA 2021) и, с другой стороны, знаменует собой начало новой эпидемии с большим разнообразием реассортантов, бесчисленные случаи заражения диких птиц и занос HPAIV H5Nx на птицефабрики с дополнительными вторичными вспышками.

    Это исследование направлено на то, чтобы представить всесторонний (фило-) генетический анализ всех обнаруженных суб- и генотипов в сезоне HPAIV 2020–21 гг. в Германии.

    2. Материалы и методы

    Полногеномное секвенирование AIV-положительных образцов было выполнено с помощью ранее описанного метода амплификации на основе нанопор (King et al. 2020a). Вкратце, экстракцию РНК с помощью набора Qiagen Mini Viral Kit (Qiagen, Германия) и последующую AIV-End-RT-PCR с Superscript III One-Step и Platinum Taq (ThermoFisher Scientific, США) для универсальной полногеномной амплификации проводили с одним праймером. пара (Pan-IVA-1F: TCCCAGTCACGACGTCGTAGCGAAAGCAGG; Pan-IVA-1R: GGAAACAGCTATGACCATGAGTAGAAACAAGG). После очистки продуктов ПЦР с помощью магнитных шариков AMPure XP (Beckman-Coulter, США) для полногеномного секвенирования использовали платформу Mk1C MinION (Oxford Nanopore Technologies, ONT, Великобритания) в сочетании с набором Rapid Barcoding Kit (SQK-RBK004, ONT ) для мультиплексирования образцов. Секвенирование проводили в соответствии с инструкциями производителя с помощью R9..4.1 проточная ячейка. За обработкой необработанных данных в реальном времени с помощью Guppy (v.4.0.11 и v.4.3.4, ONT) последовали этапы демультиплексирования, проверки качества и обрезки для удаления низкокачественных, праймерных и коротких (<50 п. н.) последовательностей. После секвенирования консенсусные последовательности полного генома были достигнуты с помощью подхода «карта к эталону» с использованием MiniMap2 (Li and Birol 2018). Эталонные геномы представляют собой тщательно подобранную коллекцию всех подтипов HA и NA наряду с набором последовательностей внутренних генов, выбранных для охвата всех потенциально циркулирующих вирусных штаммов. Полировка окончательных последовательностей генома была выполнена вручную после получения консенсуса в соответствии с наивысшим качеством (60 %) в Geneious Prime (Biomatters, Новая Зеландия). Данные, включенные в это исследование, были размещены в базе данных EpiFlu 9.0124 TM База данных GISAID (www.gisaid.org/). Соответствующие инвентарные номера можно найти в дополнительной таблице S1.

    С помощью RAxML (Stamatakis 2014) были сгенерированы специфичные для сегмента и объединенные полногеномные деревья максимального правдоподобия с использованием модели GTR GAMMA с быстрой начальной загрузкой и поиском дерева максимального правдоподобия с наилучшей оценкой вместе с 1000 повторами начальной загрузки. Для анализа филогенетического несоответствия были импортированы деревья, а верхушки идентичных штаммов выровнены с помощью дендроскопа (V3.8.1). Масштабированные по времени деревья последовательностей HA всех генотипов были рассчитаны с помощью программного пакета BEAST (V1.10.4) (Suchard et al. 2018) с использованием модели замещения GTR GAMMA, некоррелированных релаксированных часов с логарифмически нормальным распределением и сливающегося дерева постоянной популяции. модели. Длина цепочки была установлена ​​на 50 миллионов итераций, а сходимость проверена с помощью Tracer (V1.7.1). С помощью TreeAnnotator (V1.10.4) и визуализированы с помощью FigTree (V1.4.4) были созданы суммарные деревья максимальной достоверности клады (MCC) с 10-процентным апостериорным значением после выжигания в масштабе времени. Деревья MCC показывают оценки времени и их 95-процентные доверительные интервалы максимальной апостериорной плотности (HPD) в каждом узле.

    Географическое распространение было визуализировано с помощью QGIS (V3. 16, QGIS.org). Географические векторные карты geojson были получены с http://opendatalab.de/projects/geojson-utilities/ с открытыми данными, предоставленными Федеральным агентством картографии и геодезии Германии (https://gdz.bkg.bund.de/).

    3. Результаты

    3.1 Данные о крупнейшей эпизоотии HPAI среди диких и домашних птиц в Германии

    Со времени первого отчета о HPAIV H5 от 26 октября 2020 г. видов птиц, содержащихся в вольерах, таких как зоопарки), были зарегистрированы с ноября 2020 г. по март 2021 г. В целом, более 1300 случаев диких птиц и более 250 вспышек в птицеводческих хозяйствах (в основном, в хозяйствах с индейками и курами-несушками) были подтверждены как положительные на HPAI H5 во время сезона (данные на 18 октября 2021 г.). Два месячных максимума в ноябре 2020 г. и марте 2021 г. наблюдались в популяции диких птиц, поражающих в основном виды рода Anser, в то время как пик заболеваемости домашних птиц пришелся на март/апрель 2021 г. Географическое распределение случаев диких птиц показывает, что основное внимание уделяется прибрежным участкам. Германии, особенно Ваттовое море на побережье Северного моря (рис. 1). Передача уведомлений о единичных случаях продолжалась до июля 2021 г., при этом «последние» случаи у евразийского кулика-сороки ( Haematopus ostralegus, H5N1) и лебедей-шипунов ( Cygnus olor, H5N8). С октября 2021 года количество случаев заражения вирусом H5N1 накапливается, особенно вновь среди свиязей ( Mareca penelope ) и белощеких казарок (Branta leucopsis) .

    Рисунок 1.

    Открыть в новой вкладкеСкачать слайд

    Количество случаев HPAIV и географическое распределение согласно данным, собранным Немецкой системой уведомления о болезнях животных (Tierseuchennachrichten—TSN). (A) Географическая карта зарегистрированных случаев в Германии с 26 октября по 1 ноября 2020 г. (неделя 44) по 26 июля – 1 августа 2021 г. (неделя 30). (B) Динамика числа случаев по данным отчетов о диких и домашних птицах в Германии с 26 октября по 1 ноября 2020 г. (44-я неделя) по 26 июля – 1 августа 2021 г. (30-я неделя). Различают случаи заболевания диких птиц и вспышки среди птиц, содержащихся в неволе (птица, в том числе в зоопарках).

    Всего для анализа было получено 176 полных геномных последовательностей и еще 10 частичных геномных последовательностей. Эта выборка охватывает 42 последовательности полных геномов диких и 134 домашних птиц и направлена ​​​​на то, чтобы отобразить всестороннее подмножество эпизоотии с учетом времени, местоположения и затронутых видов. Подробный обзор секвенированных образцов можно найти в дополнительной таблице S1.

    3.2 Генотипирование выявляет совместную циркуляцию до пяти суб- и семи генотипов клады 2.3.4.4b вирусов HPAI H5

    Для генотипирования был проведен филогенетический анализ на основе сегментов всех немецких последовательностей, сравнивая общедоступные международные последовательности за тот же период времени и объединяя аналогичные последовательности из баз данных, представляющих возможных предков (дополнительные рисунки S1 и S2). Был проведен анализ филогенетического несоответствия немецких вирусов, чтобы дать представление о различных реассортантах (рис. 2).

    Рисунок 2.

    Открыть в новой вкладкеСкачать слайд

    Анализ филогенетического несоответствия. Деревья максимального правдоподобия сегментов HA, PB2, PB1, PA, NP и NA репрезентативных штаммов всех обнаруженных под- и генотипов с октября 2020 г. по июль 2021 г. в Германии, рассчитанные с использованием RAxML с моделью GTR GAMMA (быстрая загрузка) и 1000 бутстрап копирует. Штаммы были соединены между деревьями и верхушками, а генотипы обозначены и окрашены последовательно.

    Во время эпизоотии в Германии было идентифицировано пять подтипов HPAIV H5, охватывающих семь генотипов. Здесь генотипы помечены в соответствии с датой их первого обнаружения в Германии и их подтипом NA (Ger-Month-Year-Nx) в соответствии с предыдущими публикациями (Pohlmann et al. 2018; King et al. 2020b). Все проанализированные последовательности выявили вирусы H5, экспрессирующие идентичный сайт расщепления многоосновного гемагглютинина (PLERRKKRG), что подтверждает высокую степень патогенности.

    Первоначально и одновременно штаммы HPAI H5N8 и H5N5 были обнаружены у погибших диких птиц, обнаруженных на побережье Северного моря в Германии. Самый ранний идентифицированный генотип H5N8 (названный Ger-10-20-N8) оказался доминирующим штаммом, ответственным за >90 % всех секвенированных случаев. Этот генотип H5N8 имеет высокую идентичность по всем сегментам с ранее описанным штаммом A/chicken/Iraq/1/2020 (H5N8, EPI_ISL_623074), собранным в мае 2020 г. в Ираке и часто обнаруживаемым с лета 2020 г., сначала в Центральной Азии, а затем осенью 2020 г. в Европе и Юго-Восточной Азии (Xu et al. 2017).

    Ger-10-20-N8 сформировали генетическую основу для большинства генотипов, обнаруженных в Германии. Например, реассортант подтипа H5N5 ( Ger-10-20-N5 ) делил шесть сегментов с Ger-10-20-N8. Его NA-сегмент N5 кластеризовался со штаммом H5N5, идентифицированным в Российской Федерации в 2020 г., тогда как PA-сегмент показал наиболее тесную связь с низкопатогенными вирусами птичьего гриппа (LPAIV) подтипа h4N1, также обнаруженными в Российской Федерации в 2018 г. (рис. 3).

    Рисунок 3.

    Открыть в новой вкладкеСкачать слайд

    Схематический анализ реассортации обнаруженных суб- и генотипов в Германии, октябрь 2020 г. – июль 2021 г. Предполагаемые сегменты-предшественники помечены в соответствии с географическим происхождением и окрашены последовательно в зависимости от отношений на протяжении всего периода реассортанты.

    Помимо Ger-10-20-N8, еще два генотипа HPAI H5N8 были обнаружены только у домашней птицы. Эти новые реассортанты, названные Ger-02-21-N8 и Ger-03-21-N8 , были идентифицированы в феврале и марте 2021 года соответственно. В то время как Ger-02-21-N8 отличался от исходного штамма Ger-10-20-N8 только новым сегментом NP, который сгруппировался с LPAIV из Европы, Ger-03-21-N8 показал совершенно другое генетическое созвездие. Ger-03-21-N8 отличался в каждом сегменте, за исключением генов HA, NA и MP. Все новые сегменты можно проследить до ранее секвенированного LPAIV из Германии и Европы. Сегмент NS Ger-03-21-N8 был идентифицирован до эпизоотии в сентябре 2020 г. у штамма LPAI H5N8 из Германии (A/guinea fowl/Germany-NW/AI01184/2020, EPI_ISL_661312). В то время как Ger-03-21-N8 был первоначально обнаружен на птицеферме в Северном Рейне-Вестфалии, сегменты PB1, PA и NP, принадлежащие Ger-03-21-N8, также были обнаружены на птицеферме в Бранденбурге (январь 2021 г.). , A/turkey/Germany-BB/AI00868/2021, рис. 3 — mixH5N8), где была обнаружена смешанная инфекция Ger-10-20-N8 наряду с соответствующими сегментами. Здесь генотип Ger-10-20-N8 был идентифицирован как полный геном наряду с новыми сегментами PB1, PA и NP, связанными с соответствующими генами из Ger-03-21-N8, и дополнительным новым сегментом PB2, также наиболее тесно связан с европейским LPAIV (рис. 3).

    Европейский LPAIV также сыграл важную роль в генетическом созвездии обнаруженного подтипа HPAIV H5N3 ( Ger-12-20-N3 ). Здесь сохранились только HA- и MP-сегменты генетического остова. Все остальные сегменты показали самое близкое родство с европейским LPAIV, включая сегменты PB2 и PB1, обнаруженные в ранее описанном генотипе Ger-03-21-N8 (2021AI02290), и сегмент NP, возвращающийся к немецкому образцу LPAIV H5N8 (2020AI01184).

    Помимо штамма HPAIV H5N3, в Германии был идентифицирован совершенно новый подтип H5N4 ( Гер-02-21-N4 ). На сегодняшний день это было первое обнаружение HPAIV этого подтипа в мире. Снова несущие основные гены HA и MP, все остальные сегменты имели самое близкое родство с дальнейшими евразийскими вирусами. Сам сегмент N4 был похож на штамм H7N4 из Бангладеш, 2019 г. Сообщалось лишь о нескольких случаях этого подтипа в популяции диких птиц, затрагивающих виды чаек и уток.

    Несмотря на то, что несколько европейских стран выявили штамм HPAI H5N1 на ранней стадии европейской эпизоотии, в Германии был выявлен первый случай HPAI H5N1 не ранее февраля 2021 г. ( Гер-02-21-N1 ). И снова общая основная магистраль была представлена ​​сегментами HA и MP. Кроме того, сегменты PB2, PB1, PA и NP имели самое близкое родство с LPAIV, обнаруженным в Центральной Азии, в то время как гены NA1 и NS свидетельствовали о своем происхождении от европейского LPAIV. Эти результаты согласуются с ранее описанной генетической констелляцией подтипа H5N1 в других европейских странах. Этот реассортант повлиял как на популяции диких птиц, так и на домашнюю птицу и стал причиной многих случаев, зарегистрированных в весенне-летние и осенние месяцы 2021 г. (апрель-июль). «Последние» случаи заболевания в Германии, зарегистрированные в июле 2021 г. (H5N8, Ger-10-20-N8; H5N1, Ger-02-21-N1), свидетельствуют о длительном периоде циркуляции в популяции диких птиц.

    3.3 Филогенетический анализ Ger-10-20-N8 в масштабе времени показывает множественные вторжения в Германию

    Подробная филогения MCC в масштабе времени всех немецких и общедоступных международных сегментов HA (дополнительный рисунок S2) указывает на несколько независимых вторжений и одновременная коциркуляция различных штаммов в Европе. Доминирующий генотип Ger-10-20-N8 также показывает множественные вторжения в популяцию диких птиц Германии. Сравнение Ger-10-20-N8 с международными последовательностями указывает на сходство с вирусами, собранными в восточном, северном или северо-западном направлении, относящемся к основному региону вспышки в Германии, прибрежному региону Северного моря. Это согласуется с выводами о том, что вирусы одного и того же генотипа присутствовали в Европе в течение всего сезона (EFSA 2020, 2021).

    3.4 Ограничение подтипов и генотипов HPAIV H5 в зависимости от времени, местоположения и вида в Германии

    В течение сезона птичьего гриппа 2020/21 г. 14 федеральных земель Германии сообщили об инфекциях HPAIV. С самого начала географическое распределение показало скопление случаев заболевания диких птиц в федеральной земле Шлезвиг-Гольштейн, особенно на побережье Вадденского моря (рис. 1А). В то время как большинство сообщений о ВПГП диких птиц в 2020 г. и на протяжении большей части 2021 г. было получено из Северной Германии (Бремен, Гамбург, Мекленбург-Передняя Померания, Нижняя Саксония к северу от Ганновера и Шлезвиг-Гольштейн), случаи из Центральной (Берлин, Бранденбург, Гессен, Северный Рейн-Вестфалия, Нижняя Саксония к югу от Ганновера, Саксония, Саксония-Анхальт и Тюрингия) и Южная Германия (Бавария, Баден-Вюртемберг и Рейнланд-Пфальц) были в основном обнаружены с февраля по апрель 2021 года (дополнительный рисунок S3).

    Принимая во внимание, что было секвенировано больше образцов вспышек среди домашних птиц, чем среди диких птиц, подтипы H5N5 и H5N1 наряду с генотипом Ger-10-20-N8 (H5N8) не проявляли специфичности к хозяину, поражая как диких птиц, так и домашнюю птицу (Galliformes). Пострадавшие виды диких птиц в основном принадлежали к отряду гусеобразных. Ger-02-21-N8 и Ger-03-21-N8 были обнаружены только в птицеводческих хозяйствах, но содержали сегменты, связанные с LPAIV, обнаруженными у диких птиц. Напротив, подтип Ger-12-20-N3 (H5N3) поразил почти только диких птиц, принадлежащих к видам ржанкообразных, на побережье Ваттового моря, где была зарегистрирована массовая гибель соответствующей популяции птиц. Лишь несколько дополнительных случаев H5N3 были зарегистрированы у хищных видов птиц, охотящихся на ржанкообразных в Ваддензе. Подтип H5N4 был обнаружен только у диких птиц, поражая виды чаек и уток. Точный перечень пораженных видов птиц, относящихся к подтипу, можно найти в дополнительной таблице S2.

    Что касается временного распределения подтипов, то случаи H5N8 преобладали в зимний сезон 2020/21 года. Наряду с ведущим генотипом Ger-10-20-N8, весной 2021 года наблюдался большой приток новых случаев H5N1, продолжающийся в летние месяцы. Было зарегистрировано лишь несколько случаев H5N5 и H5N4, при этом H5N5 чаще присутствовал в начале эпизоотии, а H5N4 был обнаружен позже, весной 2021 г. Случаи H5N3 показали обширный пик в декабре 2020 г., причем почти все случаи приурочены к этому месяцу (рис. 4). .

    Рисунок 4.

    Открыть в новой вкладкеСкачать слайд

    Временное распределение подтипов, обнаруженных у диких птиц в Германии, с 26 октября по 1 ноября 2020 г. (неделя 44) по 26 июля – 1 августа 2021 г. (неделя 30), на основе данных собраны Немецкой национальной справочной лабораторией ИИ (NRL AI).

    4. Обсуждение

    И снова клада 2.3.4.4b HPAIV стала причиной крупной эпизоотии в Германии и Европе. Вспышка 2020–2021 годов превзошла все ранее зарегистрированные вспышки клады 2.3.4.4b в Германии как по количеству случаев, так и по генетическому разнообразию. Кроме того, длительный период циркуляции с обнаружениями до лета 2021 года в популяции диких птиц добавляет тревожных характеристик. Здесь возможность эндемичной циркуляции HPAIV в Европе стала реальной угрозой, и ее следует очень тщательно отслеживать. Генотип Ger-10-20-N8 был обнаружен с октября 2020 г. по июль 2021 г. в Германии, и вирусы H5N8 этого генотипа одновременно доминировали во вспышках HPAIV в Европе. Кроме того, генотип H5N1 Ger-02-21-N1 был установлен в начале 2021 г. и циркулировал в Германии как минимум до середины декабря 2021 г. Другие европейские страны сообщили о продолжающемся обнаружении HPAIV в течение лета и до осени 2021 года, включая, например, Бельгию (июль 2021 года), Нидерланды, Польшу и Финляндию (август 2021 года) и Францию ​​(сентябрь 2021 года) (FAO 2021).

    После обнаружения клады 2.3.4. 4b HPAIV H5N8 у российских птицеводов в декабре 2020 г. (Пьянкова и др., 2021) и обнаружения такого же реассортанта (Ger-10-20-N8) у других видов млекопитающих в дикой природе реабилитационного центра в Великобритании (Floyd et al. 2021) и мертвых тюленей в Германии (Postel et al. 2022), были высказаны опасения относительно зоонозного потенциала циркулирующих штаммов. Однако ни в одной из последовательностей HPAIV H5N8, проанализированных от птиц-хозяев, не было обнаружено каких-либо мутаций, которые совпадают с повышенным зоонозным потенциалом. Тем не менее, выявленный случай в Российской Федерации наряду с ранее выявленными случаями HPAIV клады 2.3.4.4b H5N6 у людей (ВОЗ, 2018 г.) подчеркивает способность вирусов ветви 2.3.4.4b адаптироваться и мутировать в зависимости от вида хозяина.

    Из всех обнаруженных суб- и генотипов сегменты HA и MP во всем очень похожи и, таким образом, могут быть обозначены как консервативный «ядерный геном». Поскольку все другие сегменты, включая сегмент NA, могут обмениваться в сочетании с этим специфическим коровым геномом, вероятность новых событий реассортации, ведущих к новым, потенциально зоонозным или эндемичным фенотипам, высока и требует тщательного анализа. Кроме того, большое количество идентифицированных генотипов подчеркивает необходимость точного и быстрого полногеномного секвенирования. Хотя стандартное тестирование RT-qPCR необходимо для диагностической работы, оценка всего генома, включая анализ вариантов для потенциальных мутаций смены хозяина, имеет первостепенное значение, особенно в отношении зарегистрированных случаев у млекопитающих. Кроме того, идентификация смешанных инфекций и реассортантов одного подтипа возможна только с помощью полногеномного секвенирования.

    Поскольку евразийские LPAIV играют важную роль в качестве источника реассортированных сегментов, отсутствие полногеномного секвенирования LPAIV, циркулирующего в Европе, затрудняет анализ, и настоятельно рекомендуются расширенные программы активного эпиднадзора за LPAIV. Поскольку многие из новых рекомбинантов были идентифицированы только в Европе, например, подтипы H5N4 и H5N3, это предполагает активную локальную рекомбинацию с циркулирующим европейским LPAIV. Здесь усиленное пассивное и активное наблюдение за штаммами LPAIV в значительной степени помогло бы в оценке потенциальных (зоонозных) новых вирусов гриппа, возможно, до их появления.

    5. Резюме

    Роль перелетных птиц и их путей распространения и передачи HPAIV была тщательно исследована (Lycett et al. 2020). Сезон птичьего гриппа 2020–2021 годов в Германии превзошел все ранее зарегистрированные вспышки HPAIV по размеру и генетической изменчивости. Внедренные вирусы HPAI H5Nx клады 2.3.4.4b затронули как популяцию диких птиц, причинив огромный экономический ущерб птицеводству, так и продемонстрировали беспрецедентную тенденцию к рекомбинации даже по сравнению с крупной эпизоотией 2016–2018 годов в Европе. Кроме того, возможный зоонозный потенциал и эндемическая угроза подчеркивают потенциальную опасность постоянно рекомбинирующихся вирусов клады 2.3.4.4b. Интенсивный активный и постоянный пассивный надзор в сочетании с полногеномным секвенированием может помочь в раннем выявлении и оценке риска новых реассортантов и вариантов HPAIV.

    Дополнительные данные

    Дополнительные данные доступны по адресу Virus Evolution онлайн.

    Благодарности

    Мы хотели бы поблагодарить Алину Максимову, Дайану Парлоу, Марин Ланж и Корнелию Иллинг за их прекрасную техническую помощь. Мы также хотели бы поблагодарить и выразить признательность всем подавшим заявку лабораториям за предоставление данных о последовательностях в базе данных GISAID.

    Эта работа была частично профинансирована соглашением о гранте программы ЕС Horizon 2020 «DELTA-FLU; нет. 727922 и ВЭО №. 874735 и Федеральным министерством образования и исследований Германии в рамках проекта «PREPMEDVET», грант №. 13Н15449.

    Доступность данных

    Все данные секвенирования, включенные в это исследование, были депонированы в базе данных EpiFlu TM GISAID (www. gisaid.org), инвентарные номера можно найти в дополнительной таблице S1.

    Конфликт интересов:

    У авторов нет конфликта интересов, о котором следует заявить.

    Ссылки

    EFSA

    . (

    2020

    ) ‘

    Обзор птичьего гриппа август — декабрь 2020 г.

    ’,

    EFSA Journal

    ,

    18

    : E06379.

    —— (

    2021

    ) ‘

    Avian Influenza Overview December 2020 — February 2021

    ’,

    EFSA Journal

    ,

    19

    : e06497.

    ФАО

    . (

    2021

    ),

    Global AIV with Zoonotic Potential Situation Update

    (

    ) accessed

    .

    Floyd

     

    T.

     и др. (

    2021

    ) ‘

    Системная инфекция высокопатогенным H5N8 птичьего происхождения вызывает энцефалит и смертность диких млекопитающих в реабилитационном центре Великобритании

    ’,

    BioRxiv

    : 2021.05.26.445666.

    Глобиг

     

    А.

     и др. (

    2017

    ) ‘

    Highly Pathogenic Avian Influenza H5N8 Clade 2. 3.4.4b In Germany in 2016/2017

    ‘,

    Frontiers in Veterinary Science

    ,

    4

    : 240.

    Кинг

     

    Дж.

     и др. (

    2020а

    ) ‘

    Рабочий процесс секвенирования нанопоры нанопора Milyblex для вирусов гриппа A

    ’,

    BMC Инфекционные заболевания

    ,

    20

    : 648.

    ,

    20

    : 648.

    . — ET. (

    2020b

    ) ‘

    Новый HPAIV H5N8 RESASORTANT (клад 2.3.4.4B) Обнаружен в Германии

    ‘,

    Вирусы

    ,

    12 9029

    221. : 281. 281. 281. 281. 281. 281.: 281. 281. v12030281

    .

    —— и др. (

    2021

    ) ‘

    Генетика высокотерогенных вирусов птичьего гриппа подтипа H5 в Германии, 2006-2020

    ‘,

    Transboundary и Emerging 9000

    2222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222н2н2н. 1136

    50

    .

    Li

     

    H.

    и

    Birol

     

    I.

    (

    2018

    ) ‘

    Minimap2: Pairwise Alignment for Nucleotide Sequences

    ’,

    Bioinformatics

    ,

    34

    :

    3094

    100

    .

    Lycett

     

    S. J.

     и др. (

    2020

    ) ‘

    Возникновение и распространение множественных реассортантов во время эпидемии птичьего гриппа H5 2016/2017 гг. в Евразии

    ’,

    Труды Национальной академии наук

    ,

    117

    :

    20814

    25

    .

    Pohlmann

     

    A.

     и др. (

    2018

    ) ‘

    Вторжение роя реассортантов высокопатогенных штаммов вируса птичьего гриппа H5N8 и H5N5, Clade 2.3.4.4b, Германия, зима 2016/17

    ’,

    5 Scientific Reports

    ,

    8

    : 15.

    Postel

     

    A.

     et al. (

    2022

    ) ‘

    Инфекции с высоким патогенным вирусом птичьего гриппа A (HPAIV) H5N8 в уплотнениях гавани на побережье Немецкого Северного моря, 2021

    ‘,

    Emerge Microbes Infect

    22222222222222222,

    Инфекция Emerge Microbes

    22222222222222222222,

    .

    725

    9

    .

    Пьянкова

     

    О. Г.

     и др. (

    2021

    ) ‘

    Выделение высокопатогенного вируса птичьего гриппа Clade 2.3.4.4b A(H5N8) у рабочего во время вспышки на птицефабрике, Россия, декабрь 2020 г.

    ‘,

    EuroSurveillance

    ,

    26

    : 24.

    Stamatakis

    A.

    (

    2014

    222222222222) ‘

    (

    2014

    222222222222222 годы). Филогении

    ’,

    Биоинформатика

    ,

    30

    :

    1312

    3

    3

    3

    Сушард

     

    М. А.

     и др. (

    2018

    ) ‘

    Байесовская филогенетическая и филодинамическая интеграция данных с использованием Beast 1.10

    ’,

    Evolution

    ,

    4

    2: VEY016.

    Суитон

     

    E.

     и др. (

    2020

    ) ‘

    Африка Африки к югу от Сахары и вирус Евразии вируса с экологически чистым патогенным гриппом A (H5N8), Европа, декабрь 2019

    ‘,

    .

    :

    1557

    61

    .

    ВОЗ

    . (

    2018

    ),

    Антигенные и генетические характеристики вирусов зоонозного гриппа и разработка вакцинных вирусов-кандидатов для обеспечения готовности к пандемии

    доступ

    .

    Сюй

     

    W.

     и др. (

    2017

    ) ‘

    Анализ геномной сигнатуры недавно появившегося высокопатогенного вируса птичьего гриппа A(H5N8): выявление эволюционной тенденции передачи инфекции от птицы человеку

    ,

    19

    :

    597

    604

    .

    Сюй

     

    X.

     и др. (

    1999

    ) ‘

    Генетическая характеристика патогенного вируса гриппа A/Goose/Guangdong/1/96 (H5N1): сходство его гемагглютининового гена с генами вирусов H5N1 во время вспышек 1997 г. в Гонконге

    ,

    Вирусология

    ,

    261

    :

    15

    9

    .