Печатная тетрадь по биологии 10 класс: ГДЗ по биологии 10 класс рабочая тетрадь Агафонова, Сивоглазов Решебник Базовый уровень

Содержание

ГДЗ по биологии 10 класс рабочая тетрадь Агафонова, Сивоглазов Решебник Базовый уровень

Решение есть!
  • 1 класс
    • Математика
    • Английский язык
    • Русский язык
    • Музыка
    • Литература
    • Окружающий мир
  • 2 класс
    • Математика
    • Английский язык
    • Русский язык
    • Немецкий язык
    • Информатика
    • Музыка
    • Литература
    • Окружающий мир
    • Технология
  • 3 класс
    • Математика
    • Английский язык
    • Русский язык
    • Немецкий язык
    • Информатика
    • Музыка
    • Литература
    • Окружающий мир
    • Казахский язык
  • 4 класс
    • Математика
    • Английский язык
    • Русский язык
    • Немецкий язык
    • Информатика
    • Музыка
    • Литература
    • Окружающий мир
    • Казахский язык
  • 5 класс
    • Математика
    • Английский язык
    • Русский язык

ГДЗ к рабочей тетради по биологии 10 класс Лисов, Лемеза

Решебники, ГДЗ

  • 1 Класс
    • Математика
    • Русский язык
    • Английский язык
    • Информатика
    • Немецкий язык
    • Литература
    • Человек и мир
    • Природоведение
    • Основы здоровья
    • Музыка
    • Окружающий мир
    • Технология
  • 2 Класс
    • Математика
    • Русский язык
    • Белорусский язык
    • Английский язык
    • Информатика
    • Украинский язык
    • Французский язык
    • Немецкий язык
    • Литература
    • Человек и мир
    • Природоведение
    • Основы здоровья
    • Музыка
    • Окружающий мир
    • Технология
    • Испанский язык
  • 3 Класс
    • Математика
    • Русский язык
    • Белорусский язык
    • Английский язык
    • Информатика
    • Украинский язык
    • Французский язык

Рабочая тетрадь по биологии для студентов 1 курса | Методическая разработка по биологии (10 класс) на тему:

Урок № 3

Тема: Учение о клетке. Химическая организация клетки.

Цель: Дать понятие термину «клетка». Изучить химический состав клетки. 

1. ________________— элементарная живая система (бактерий, простейших, одноклеточных, водорослей, грибов) и основная структурно-фун­ кциональная единица всех живых организмов.
Термин «_________» используется в науке более 300 лет. Впервые его применил в середине XVII в. президент Британского Королевского общества_________________. С помощью микроскопа он ________________________________________________________.

Около ста лет назад исследования строения, функций, состава, развития клеток оформились в особую биологическую науку — ________________ (от греч. cytos — _________ + logos — ___________). Современная комплексная наука «_____________» изучает _____________________________________________________________________
______________________________________________________________________________________________________________________________________________________________________________________________________________________________________.

2. В состав клетки входит более 70 химических элементов периодической системы Д. И. Менделеева.

Химические элементы в зависимости от содержания их в живом организме подразделяют на:

Макроэлементы — __________________________________________________________

Микроэлементы — __________________________________________________________

Ультромикроэлементы — ____________________________________________________

В клетках некоторых организмов обнаружено повышенное содержание отдельных химических элементов. Например, бактерии способны накапливать марганец, морские водоросли – йод, ряска – радий, моллюски и ракообразные – медь.

        В соединении с органическими веществами особое значение имеют сера, входящая в состав многих белков, фосфор как обязательный компонент нуклеотидов ДНК и РНК, железо, находящееся в составе белка крови гемоглобина, и магний, содержащийся в молекуле хлорофилла. Кроме того, фосфор в форме нерастворимого фосфорнокислого кальция составляет основу костного скелета позвоночных и раковин моллюсков.

Вода. Большое значение в жизнедеятельности клетки имеет вода. В среднем в многоклеточном организме вода составляет около 80 % массы тела.

Функции воды в клетке:

1_________________________________           2__________________________________

3_________________________________           4__________________________________

5_________________________________           6__________________________________

7_________________________________           8__________________________________


Белки — основная составная часть любой живой клетки. На их долю приходится _________ % сухой массы клетки. Белки — это полимеры, их составными единицами (мономерами) являются _____________________. Всего известно _____________________________________, входящих в состав белков; каждая из них имеет карбоксильную группу (-СООН), аминогруппу (Nh3) и радикал (R). 

В белке каждая аминокислота может соединиться с другой посредством пептидных связей (—СО — NH—), в которых углерод карбоксильной группы одной аминокислоты соединяется с азотом аминогруппы последующей аминокислоты. При этом от аминогруппы отделяется ион Н+, а от карбоксила — радикал ОН с образованием молекулы воды. Соединение, состоящее из двух или большего числа аминокислотных остатков, называется ____________________________.

Выделяют четыре уровня структурной организации белков:

1.  __________________________________________________________________________
________________________________________________________________________________________________________________________________
___________________________________________________
___________________________________________________
___________________________________________________
__________________________________________________
__________________________________________________

2.____________________________________________________________________________ _____________________________________________________________________________

_____________________________________________________________
_____________________________________________________________
_____________________________________________________________
_____________________________________________________________
_____________________________________________________________
3. ____________________________________________________________
__________________________________
___________________________________
____________________________________
____________________________________
_______________________________
_______________________________
_______________________________
_______________________________
______________________________
______________________________

______________________________
______________________________
4. _____________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________


Основные функции белков:

1._________________________________________________________________________________________________________________________________________________________

2. ___________________________________________________________________________
_____________________________________________________________________________
3____________________________________________________________________________
_____________________________________________________________________________
4.___________________________________________________________________________
____________________________________________________________________________

5____________________________________________________________________________
_____________________________________________________________________________
6.___________________________________________________________________________
____________________________________________________________________________

Углеводы (сахара) встречаются как в животных, так и растительных клетках, причем в растительных клетках их значительно больше.

Углеводы являются соединениями углерода, водорода и кислорода. Различают:

1._________________________________________________________________________________________________________________________________________________________

2. ___________________________________________________________________________
_____________________________________________________________________________
3____________________________________________________________________________
____________________________________________________________________________

Главными углеводами клеток являются _________________________________________
(у животных), ______________________________________________________ (у растений)

Основные функции углеводов:

1._________________________________________________________________________________________________________________________________________________________

2. ___________________________________________________________________________
_____________________________________________________________________________
3____________________________________________________________________________
_____________________________________________________________________________

4. ____________________________________________________________________________
_____________________________________________________________________________

Липиды. Большинство липидов — ________________________________________
_____________________________________________________________________________. Простые липиды включают вещества, молекулы которых состоят только из остатков _______________________________________________________________. Именно этим кислотным остаткам липиды обязаны своим важным биологическим свойством — крайне малой растворимостью в воде.

Самые распространенные из липидов — жиры и воски. Жиры представляют собой эфиры трехатомного спирта глицерина и жирных кислот.

Функции липидов:

1_________________________________           2__________________________________

3_________________________________           4__________________________________

5_________________________________           6__________________________________

7_________________________________           8__________________________________


Нуклеиновые кислоты — это _________________________________________
_____________________________________________________________________________
Впервые были обнаружены ______________________________________________
____________________________________________________________________________

Значение — ____________________________________________________________________

Существует два типа нуклеиновых кислот:

1 ДНК _____________________________________________________________________
_____________________________________________________________________________
____________________________________
____________________________________

____________________________________
____________________________________

____________________________________
____________________________________

____________________________________
_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________


2. РНК — это__________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
____________________________________
____________________________________
____________________________________
___________________________________
___________________________________

____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________

АТФ — это____________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________


_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

Вывод: ______________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

Работу выполнил студент:

_________________________________________________________________________

Работу принял преподаватель:

Оценка, подпись_________________________________/____________________________/


Урок № 4

Тема: Строение и функции клетки. Цитоплазма и клеточная мембрана.

Цель: ________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________

1. В настоящее время выделяют два уровня клеточной организации: __________________________________________ и _________________________________.

Прокариотическая клетка. 

_____________________ — это типичные прокариотические клетки. Бактериальная клетка окружена клеточной стенкой, представляющей собой «мешок», в котором заключено клеточное содержимое. На поверхности клеточной стенки у бактерий могут располагаться _____________________. Отличительным признаком ряда бактериальных видов является _____________________________, расположенная снаружи от клеточной стенки. Главная особенность строения бактерий — _____________________________________________________________________________. Основное вещество бактериальных клеток представлено ____________________________

3. Пользуясь учебником, опишите строение прокариотической клетки.
_______________________________________________________

________________________________________________________

________________________________________________________

________________________________________________________

________________________________________________________

________________________________________________________

________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________


Эукариотическая клетка.  

Наиболее сложная организация свойственна _________________________________. Так называемой типичной клетки в природе не существует, но у тысяч различных видов клеток можно выделить общие черты строения. Каждая клетка состоит из двух важнейших, тесно взаимосвязанных частей — цитоплазмы и ядра.

Пользуясь учебником, подпишите, указанные на рисунке части клеток:

А._________________________________
Б._________________________________
1.__________________________________
2.__________________________________
3._________________________________
4._________________________________
5.__________________________________
6.__________________________________
7._________________________________
8._________________________________
9.__________________________________
10._________________________________
11._________________________________
12._________________________________
13._________________________________
14._________________________________
15. ________________________________

2. Цитоплазма и клеточная мембрана.

От внешней среды цитоплазма отграничена наружной _______________________________ (цитоплазматической мембраной, плазматической мембраной, плазмалеммой). Плазматическая мембрана — плотная ультрамикроскопическая пленка (толщина 7—10 нм), состоящая из нескольких слоев. Центральный слой представлен__________________________________________________________________, в которые на разную глубину с наружной и внутренней стороны погружены многочисленные и разнообразные молекулы белка.

У большинства растительных клеток помимо мембраны снаружи имеется еще толстая целлюлозная оболочка — клеточная стенка. Она выполняет опорную функцию за счет жесткого наружного слоя, придающего клеткам четкую форму.

Подпишите составные части мембраны:_______________
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________


Биологические функции цитоплазматической мембраны:

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________

________________________________________

________________________________________

________________________________________

________________________________________

________________________________________

________________________________________

Гиалоплазма (цитоплазматический матрикс) — _____________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

Роль гиалоплазмы в клетке:

_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

Вывод: ______________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

Работу выполнил студент:

_________________________________________________________________________

Работу принял преподаватель:

Оценка, подпись_________________________________/____________________________/


Группа ___________ФИО студента __________________________

Самостоятельная работа по теме: «Химическая организация клетки»

Вариант —


Урок № 5

Тема: Органоиды клетки. Ядро и хромосомы. Вирусы.

Цель: _____________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________

1. Используя материал, предложенный в учебнике, заполните таблицу.

Таблица. Характеристика органоидов клетки

Название

Строение

Функции

1

2

3

4

5

6

7

8

9

10

11

12

Пользуясь параграфом учебника 1. 2.3 (стр.33) выпишите особенности строения растительной клетки_______________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________

2. Вирусы. Вирусы открыты в 1892 г. русским ученым________________________, который описал необычные свойства возбудителя болезни табака, получившего название ________________________________________________. Термин «вирус» (от лат. virus — ___________) предложен в ___________________ г. голландским ботаником и микробиологом __________________________________________.

Вирусы — неклеточная форма жизни на Земле. Вирусы резко отличаются от всех других форм жизни. Они не имеют ____________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

Формы существования вирусов:

1.____________________________________________________________________________


2.___________________________________________________________________________
В активном состоянии вирусы пребывают, только находясь _________________________
_____________________. Вирусы способны проникать в определенные живые клетки и размножаться только внутри этих клеток. Таким образом, вирусы — это____________
______________________________________. Вирусы, подобно всем другим организмам, обладают собственным генетическим аппаратом, который кодирует синтез вирусных частиц из биохимических предшественников, но активизируется только при _____________________________________________________________________________.

Опишите строение вирусов (простых и сложных): _____________
____________________________________________________________
____________________________________________________________
____________________________________________________________
____________________________________________________________
____________________________________________________________
____________________________________________________________
____________________________________________________________
____________________________________________________________

По содержанию нуклеиновых кислот вирусы делятся на: ____________________________
_____________________________________________________________________________
_____________________________________________________________________________

Бактериофаги. (подпиши рисунок, перепиши из учебника этапы проникновения бактериофага в клетку хозяина) _________________________________________________
_________________________________________________
__________________________________________________
_________________________________________________
__________________________________________________
__________________________________________________
_________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
__________________________________________________________________________________________________________________________________________________________
_____________________________________________________________________________


Вирусы распространены в природе повсеместно и поражают все группы живых организмов.  Вирусы вызывают самые разнообразные болезни человека: ______________
_____________________________________________________________________________
и др. Массовую гибель животных вызывают ящур, чума свиней и птиц, инфекционная анемия лошадей. Крупные убытки наносят растениеводству мозаичная болезнь табака, томатов, огурцов, Х-вирус картофеля, различные виды желтухи, карликовости. Бактериофаги нередко подавляют развитие полезных микроорганизмов при производстве антибиотиков или молочнокислом брожении.

Вирусы очень устойчивы. Они переносят высушивание и низкие температуры. При нагревании до 55— 60 °С часть вирусов погибает, часть выдерживает температуры до 90 °С. Многие вирусы длительно устойчивы к действию спиртов, эфиров и других сильно влияющих на бактерии химических веществ. Под действием ультрафиолетовых лучей большинство вирусов погибает.

Вывод: ______________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________

Работу выполнил студент:

_________________________________________________________________________

Работу принял преподаватель:

Оценка, подпись_________________________________/____________________________/


Урок № 6

Тема: Обмен веществ и превращение энергии к летке.

Цель: _____________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________ 

1. В клетках постоянно осуществляются обмен веществ – метаболизм.

Метаболизм – это _____________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

Благодаря обмену веществ ___________________________________________________
_______________________________________, входящие в состав клетки, непрерывно расщепляются и синтезируются. Благодаря этому в клетках достигается относительное постоянство состава, образование, разрушение и обновление клеточных структур и межклеточного вещества.

Обмен веществ складывается из двух взаимосвязанных, одновременно протекающих в организме процессов — ___________________________ и ____________________
______________________ обменов.

Пластический обмен (анаболизм, ассимиляция) —_______________________________
_____________________________________________________________________________. Эти вещества идут на ______________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________.
Пластический обмен всегда сопровождается ______________________________________.

Энергетический обмен (катаболизм, диссимиляция) — ___________________________
_____________________________________________________________________________
— белков, нуклеиновых кислот, жиров, углеводов на более простые, низкомолекулярные. При этом _______________________________ энергия, заключенная в химических связях крупных органических молекул. Освобожденная энергия запасается в форме _____________________________________________________________________________.

2. Пластический обмен.

Суть пластического обмена заключается в том, что из простых веществ, поступающих в клетку извне, образуются вещества клетки.

Все процессы обмена веществ в клетке и целом организме протекают под контролем наследственного аппарата. Рассмотрим один из важнейших процессов реализации наследственной информации – биосинтез белка.

Роль белков в организме огромна. Вспомните и напишите основные функции белков:

1_________________________________           2__________________________________

3_________________________________           4__________________________________

5_________________________________           6__________________________________

7_________________________________           8__________________________________

В синтезе белка — этом сложном, многоступенчатом процессе — участвуют ___________
_____________________________________________________________________________
_____________________________________________________________________________

Основная роль в определении структуры белка принадлежит ________________________.
В ней закодирована информация о последовательности аминокислот в молекуле белка.

Ген – это_____________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

Каждый вид животных и растений имеет особый, характерный только для него набор белков. Белки состоят из аминокислот (смотри урок 3), а каждой аминокислоте в полипептидной цепочке соответствует  ___________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
Связь между нуклеотидом и аминокислотами называется ___________________________
_____________________________________________________________________________
В состав белков входит _____________________аминокислот.

Синтез белка осуществляется на _________________________, а информация о структуре белка зашифрована в __________________, расположенной в ядре. Для того чтобы синтезировался белок, информация о последовательности аминокислот в его первичной структуре должна быть доставлена к рибосомам. Этот процесс включает два этапа: _______________________________ и ______________________________.

Транскрипция (буквально — переписывание) _____________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

Трансляция — _________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________


3. Энергетический обмен.

Диссимиляция – это___________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
В энергетическом обмене выделяют 3 этапа:

1. ___________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

2. ___________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
Напишите суммарное выражение процесса:

_____________________________________________________________________________

3. ___________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

Напишите суммарное выражение процесса:

_____________________________________________________________________________


4. Дайте понятие фотосинтез, опишите/зарисуйте основные фазы фотосинтеза

Фотосинтез — _____________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________.


Вывод: ______________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

Работу выполнил студент:

_________________________________________________________________________

Работу принял преподаватель:

Оценка, подпись_________________________________/_____________________


Группа ___________ФИО студента __________________________

Самостоятельная работа по теме:

 «Органоиды клетки. Ядро и хромосомы. Вирусы.»

Вариант —


Урок № 9

Тема: Деление клетки.

Цель: _____________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________

1. Деление клетки — _______________________________________________
__________________________________________________________________.
Увеличение числа клеток происходит в результате их деления. Деление клеток лежит в основе_______________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
Типы деления:

1) простое — _________________________________________________________________

2) сложное:

А)______________________        Б)____________________        В)_____________________

2.Жизненный цикл клетки. Митотический цикл.

Жизненный цикл клетки — _____________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

Митотический цикл — __________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

Этот цикл состоит из :

1)____________________________________        2)__________________________________

1) Интерфаза состоит из 3 периодов:

G1__________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

S____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

G2___________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

3. Митоз — ____________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

1) Профаза
_____________________________
_____________________________
_____________________________
_____________________________
_____________________________
_____________________________
_____________________________
_____________________________
_____________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

2) Метафаза
___________________________________
___________________________________
___________________________________
___________________________________
___________________________________
___________________________________
___________________________________
___________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________


3) Анафаза
_____________________________________
_____________________________________
_____________________________________
____________________________________
____________________________________
____________________________________
____________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
4) Телофаза
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
Цитокинез — __________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

4. Амитоз — ___________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
Какие ткани могут делиться амитозом?___________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

5. Мейоз — ____________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________


Заполните табличку, используя материал учебника.

Название фазы

Рисунок

Описание процессов


Вывод: ______________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

Работу выполнил студент:

_________________________________________________________________________

Работу принял преподаватель:

Оценка, подпись_________________________________/____________________________/


Урок № 10

Тема: Размножение и оплодотворение.

Цель: _____________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________

1. Размножение живых организмов может быть:

а) _______________________         б) _________________________

2. Бесполое размножение — __________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

Пользуясь учебником, найдите ответы на вопросы:

1) Сколько особей участвуют при бесполом размножении?________________________

2) Каким способом делится клетка, из которой образуется дочерняя особь?__________
_____________________________________________________________________________

3) Выпишите и охарактеризуйте виды бесполого размножения

а) _________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
б) _________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
в) _________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
г) _________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________


4) Таким образом, в результате бесполого размножения воспроизводится большое число________________________________________________________________________

3. Половое размножение_______________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

Гаметы – это _________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

а) женские половые клетки – это ________________________________________________

б) мужские половые клетки – это ________________________________________________,
у высших растений — ___________________________________________________________

Зигота – это ___________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

В чем заключается преимущество полового размножения над бесполым?_______________
_____________________________________________________________________________
_____________________________________________________________________________

Партогенез – это______________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

4.                                 Образование половых клеток

Опишите, указанные выше процессы, пользуясь учебником.

1) ___________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

2) ___________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

5. Оплодотворение у животных (опишите процесс оплодотворения)
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________


6. Оплодотворение у растений (опишите или зарисуйте процесс оплодотворения, пользуясь материалом учебника или Интернет-источниками)

Вывод: ______________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

Работу выполнил студент:

_________________________________________________________________________

Работу принял преподаватель:

Оценка, подпись_________________________________/____________________________/


Урок № 11-12

Тема: Онтогенез. Развитие зародыша. Нарушение развития зародышей.

Цель: ________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________

1. Термин «онтогенез» был введен в науку в 1866 году ___________________________

Онтогенез – это __________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________

Этапы онтогенеза

____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________

2. Стадии ________________________________этапа онтогенеза

1).__________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

2).__________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________


3).__________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
Эмбриональная индукция — _____________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________


3. ________________________________(или послезародышевый) период развития начинается___________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

Различают 2 вида постэмбрионального развития:

1.___________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

2.___________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________


4. Нарушение развития зародышей.

Напишите факторы, влияющие на развитие зародыша _______________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

Вывод: ______________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

Работу выполнил студент:

_________________________________________________________________________

Работу принял преподаватель:

Оценка, подпись_________________________________/____________________________/


Группа ___________ФИО студента __________________________

Самостоятельная работа по теме:

«Организм. Размножение и индивидуальное развитие организмов.»

Вариант —


Урок № 13

Тема: Генетика, как наука. Законы генетики. Генетика пола.

Цель: _____________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________ 

1. Генетика – это ______________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
____________________________________________________________________________

Как наука генетика существует с 1900 г., когда несколькими учеными (X. Де Фриз, К. Корренс, Э. Чермак) независимо друг от друга были переоткрыты закономерности наследования родительских признаков, которые экспериментально установил еще в 1865 г. чешский естествоиспытатель Г.Мендель. На основе проведенного статистического анализа результатов скрещиваний гороха с разными признаками он сформулировал несколько правил, которые впоследствии получили название законов Менделя.

2. Основные понятия и символика генетики:

Ген — это____________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
Локус – это __________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
Доминантный признак — ________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
Рецессивный признак — ________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
Гомозигота — это_______________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
Гетерозигота — это______________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
Генотип – это ______________________________________________________________
__________________________________________________________________________________________________________________________________________________________
Фенотип – это _______________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________


Родительская особь обозначается_________________________________________________
Знак скрещивания _________________________________________________________
Женская особь_________________________________________________________
Мужская особь________________________________________________________
Гаметы ______________________________________________________________________
Гомозигота по доминантному признаку____________________________________________
Гомозигота по рецессивному признаку____________________________________________
Гетерозигота__________________________________________________________________

3. Законы Менделя:

Моногибридное скрещивание —  _____________________________
__________________________________________________________
__________________________________________________________
__________________________________________________________
Первый закон Менделя (закон единообразия гибридов первого поколения)._______________________________________________
__________________________________________________________
__________________________________________________________
__________________________________________________________
Задача 1.

У гороха желтый окрас семян является доминантным признаком, а зеленый – рецессивным. Какими будут гибриды первого поколения при скрещивании растения гомозиготного по доминантному признаку с растением, гомозиготой – по рецессивному признаку.

Дано:                                                        Решение

Объект –

Найти —

Ответ:


Неполное доминирование — ___________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
Задача 2.

При скрещивании растения «ночная красавица» с белыми цветками (гомозиготного рецессивного «aa») с растением, у которого цветки красные (гомозиготный доминант «AA»), какими будут гибриды первого поколения?

Дано:                                                        Решение

Объект –

Найти –

Ответ:

Второй закон Менделя (закон расщепления) — ___________________________________
_____________________________________________________________________________
_____________________________________________________________________________
Задача 3.

У гороха желтый окрас семян является доминантным признаком, а зеленый – рецессивным. Какими будут гибриды первого поколения при скрещивании двух гетерозиготных растений?

Дано:                                                        Решение

Объект –

Найти –

Ответ:


Закон чистоты гамет — _________________________________________________________
_____________________________________________________________________________

Дигибридное скрещивание — ___________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
Третий закон Менделя — _______________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
Задача 4.

У гороха жёлтая окраска семян доминирует над зелёной, а гладкая форма семян над морщинистой. Скрещено гомозиготное по доминантному признаку растение с гомозиготным по рецессивному признаку растением. а) Определите возможные генотипы и фенотипы потомков. б) Определите каким будет потомство при скрещивании гибридов первого поколения между собой?

Дано:                                                        Решение

Объект –

Найти —


Ответ: а)

        б)


Задача 5.

Черная окраска шерсти у крупного рогатого скота определяется доминантным геном В, а красная — рецессивным b. Каким будет F1 от скрещивания гомозиготного черного быка с красной коровой?

Дано:                                                        Решение

Объект –

Найти —

Ответ:

Вывод: ______________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

_____________________________________________________________________________
_____________________________________________________________________________

Работу выполнил студент:

_________________________________________________________________________

Работу принял преподаватель:

Оценка, подпись_________________________________/____________________________/


Раюочая тетрадь по биологии «Общая биология» 10-11 класс, 1 курс

Министерство общего и профессионального образования Ростовской области Кулешовский филиал
государственного бюджетного профессионального образовательного учреждения Ростовской области
«Азовский гуманитарно-технический колледж»

БИОЛОГИЯ

Рабочая тетрадь

для студентов среднего профессионального образования

Как работать с тетрадью

Эта тетрадь предназначена для самостоятельной работы на занятиях и дома. В нее включены вопросы и задания. К каждой теме даны вопросы, задания разных уровней сложности, требующие простого воспроизведения изученного материала или творческого подхода к решению вопросов, задач.

Кроме работы с текстом учебника, вам предстоит выполнить задания с рисунками в тетради, решить кроссворды, подготовить презентации.

«Введение в биологию»

  1. Что такое биология?

_______________________________________________________________________________________________________________________________________________________________

  1. Перечислите основные признаки живого.

____________________________________________________________________________________________________________________________________________________________________________________________________________________

  1. Перечислите уровни организации живой материи.

_________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

  1. Какие существуют методы изучения биологии?

____________________________________________________________________________________________________________________________________________________________________________________________________________________

  1. Каково значение биологии в вашей будущей профессии?

____________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

Тема: «Учение о клетке»

  1. История развития клетки

Основные положения клеточной теории:

__________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

_______________________________________________________

Что является структурной и функциональной единицей живых организмов? (определение)

_______________________________________________________

2. Какое самое распространенное неорганическое соединение в живых организмах? Каково его значение?

_____________________________________________________________________________________________________________________________________________________________________

_______________________________________________________

3. Что называют макроэлементами?

______________________________________________________________________________________________________________

_______________________________________________________

4. Что называют микроэлементами?

_____________________________________________________________________________________________________________________________________________________________________

Для чего необходимы минеральные соли в организме?

_____________________________________________________________________________________________________________________________________________________________________

5. Как называют способность клетки поддерживать слабощелочную реакцию своего содержимого на постоянном уровне?

_______________________________________________________

6. Сколько, в среднем, процентов составляют органические соединения в массе живого организма?

______________________________________________________________________________________________________________

7. Какое органическое вещество занимает первое место по количеству и по значению в клетке?

_______________________________________________________

8. Напишите общую формулу аминокислот.

_______________________________________________________

9. Что принято называть первичной структурой белка? _____________________________________________________________________________________________________________________________________________________________________

10. Вследствие чего возникают гидрофобные взаимодействия?

______________________________________________________________________________________________________________

11. Сколько у белков уровней структурной организации. Опишите их.

_______________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

12. Что такое ренатурация?

_____________________________________________________________________________________________________________________________________________________________________

13. Какое значение несет каталитическая роль белков?

____________________________________________________________________________________________________________________________________________________________________________________________________________________________

14. Что такое ферменты?

____________________________________________________________________________________________________________________________________________________________________________________________________________________________

15. Напишите общую формулу углеводов.

_______________________________________________________

16. Решите кроссворд.

Вопросы:

1.Какой термин буквально означает «развязывание», «освобождение»?

2. Утрата структуры, присущей данной белковой молекуле?

3. Нерастворимые в воде органические вещества, которые можно извлечь из клеток органическими растворителями?

4. Сложные углеводы, образованные остатками многих моносахаридов?

«Строение и функции клеток»

  1. Эукариотическая клетка. Ядро.

Задание 1. Ответьте, почему клетку называют саморегулирующейся, самовоспроизводящейся и открытой системой?

___________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

Задание 2. Перечислите основные структурные компоненты ядра. Назовите его функции.

_________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

Задание 3. Рассмотрите, какое строение и химический состав имеют хромосомы?

_______________________________________________________________________________________________________________________________________________________________

Задание 4. Какие функции выполняют хромосомы?

______________________________________________________________________________________________________________________________________________________________________________

Задание 5. Чем отличаются наборы хромосом в соматических и половых клетках, гомологичные хромосомы от негомологичных?

____________________________________________________________________________________________________________________________________________________________________________________________________________________________

Задание 6. Объясните, используя рисунок особенности строения плазматической мембраны.

Какие функции она выполняет?

____________________________________________________________________________________________________________________________________________________________________________________________________________________

Задание 7. В чем проявляется избирательная проницаемость плазматической мембраны?

_____________________________________________________________________________________________________________________________________________________________________

Задание 8. Чем клеточная оболочка отличается от плазматической мембраны?

__________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

Задание 9. Какими путями вещества поступают в клетку? Рассмотрите рисунок и назовите процессы:

____________________________________________________________________________________________________________________________________________________________________________________________________________________________

Задание 10. Что представляет собой цитоплазма? Каковы ее функции?

____________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

Задание 11. Назовите органоиды клетки, изображенные на рисунке и подпишите их части:

Задание 12. Допишите предложения

1. Внутренняя полужидкая среда митохондрии называется _______________________________________________________2. Структурно-функциональная единица хлоропласта – это ­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­ _______________________________________________________3. Одиночный тилакоид, соединяющий соседние граны, называется _______________________________________________________4. Хромопласты – это ______________________________________________________________________________________________________________

5. Основная функция хлоропласта – _______________________________________________________

6. Внутренняя полужидкая среда хлоропласта называется _______________________________________________________7. Многочисленные складки внутренней мембраны митохондрии — это _______________________________________________________

8. Тилакоиды собраны в стопки, называемые — _______________________________________________________9. Лейкопласты– это ______________________________________________________________________________________________________________10. Основная функция митохондрии – это _______________________________________________________

Задание 13. Заполните таблицу:

Строение эукариотической клетки.

Название органоидов

Строение

Функции

  1. Плазматическая мембрана

  1. Надмембранный комплекс:

а) гликокаликс

б) клеточная стенка

  1. Ядро

а) ядерная оболочка

б) кариоплазма

в) ядрышки

г) хроматин

д) хромосомы

  1. Цитоплазма

  1. Эндоплазматическая сеть

  1. Комплекс Гольджи

  1. Лизосомы

  1. Митохондрии

  1. Пластиды

а) хлоропласты

б) хромопласты

в) лейкопласты

  1. Рибосомы

  1. Микротрубочки

  1. Микрофиламенты

  1. Клеточный центр

  1. Органеллы движения: реснички и жгутики

  1. Включения

Задание 14. Подпишите названия органоидов, изображенных на рисунке:

_____________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________Задание 15. Распределите приведенные клеточные органоиды в три столбика:

а) вакуоли; б) микротрубочки; в) ЭПС; г) микрофиламенты; д) рибосомы; е) лизосомы; ж) хромосомы; з) клеточный центр; и) комплекс Гольджи ; к) митохондрии; л) хлоропласты; м) хромопласты; н) лейкопласты; о) ядро.

Задание 16.Допишите определения:

1. По строению клетки все живые существа делятся на _______________________________________________________

2. Любая клетка снаружи покрыта _______________________________________________________

3. Внутренней средой клетки является _______________________________________________________

4. Структуры, постоянно присутствующие в клетке, называются _______________________________________________________

5. Органоид, участвующий в образовании и транспортировке различных органических веществ, – это ____________________________________________________

6. Органоид, участвующий во внутриклеточном переваривании пищевых частиц, отмерших частей клетки, называется _____________________________________________________

7. Зеленые пластиды называются __________________________________________________

8. Вещество, содержащееся в хлоропластах, называется ____________________________________________________

9. Прозрачные пузырьки, заполненные клеточным соком, называются _______________________________________________________

10. Местом образования белков в клетках являются _________________________________________________

11. Наследственная информация о данной клетке хранится в _________________________________________________

12. Энергия, необходимая клетке, образуется в ______________________________________________________

13. Процесс поглощения клеткой твердых частиц называется __________________________________________________

14. Процесс поглощения клеткой жидкости называется _____________________________________________

Задание 17. Закончите предложения.

1. Растительная клетка, в отличие от животной, содержит плотную целлюлозную ______________________ 2. В центре старой растительной клетки находится крупная центральная _______________заполненная_____________________3. Клетки зелёных частей растений содержат зелёные пластиды, называемые ________________, которые выполняют функцию _________________ 4. Плоды растений часто имеют яркую окраску, обусловленную присутствием в клетках красных и оранжевых пластид, называемых ______________ 5. Сходство в строении растительной и животной клеток свидетельствует о _______________________________________________________.

Задание 18. Распределите приведенные клеточные органоиды в три столбика:

а) плазмалемма; б) цитоплазма; в) ЭПС; г) центральная вакуоль; д) рибосомы; е) лизосомы; ж) клеточная стенка; з) клеточный центр; и) комплекс Гольджи ; к) митохондрии; л) хлоропласты; м) хромопласты; н) лейкопласты; о) ядро.

II, Прокариотическая клетка

Задание 19. Рассмотрите клетку бактерии и впишите обозначения:

Задание 20. Чем прокариотические клетки отличаются от эукариотических. Выберите необходимые параметры в соответствии с заданием:

1-й вариант – прокариоты, 2-й вариант – эукариоты.

1.Есть ядро, окруженное ядерной мембраной.
2. Ядра нет, есть нуклеарная область.
3. растения, животные, грибы.
4. бактерии.
5. отсутствуют митохондрии, ЭПР, лизосомы;
6. есть мембранные структуры внутри клетки;
7. ДНК- линейный нуклеопротеид, содержит белок;
8. ДНК замкнута в кольцо;
9. одноклеточные;
10. одноклеточные и многоклеточные

11. Есть рибосомы.

12. Есть клеточная стенка

13. Все организмы одноклеточные.

14. Есть и одноклеточные и многоклеточные организмы.

Задание 21. Найдите ошибки в тексте:

Прокариоты – это организмы, клетки которых имеют ограниченное мембраной ядро. Размножаются они делением. В клетках содержатся хлоропласты, митохондрии, аппарат Гольджи, центриоли. По способу питания они могут быть как автотрофами, так и гетеротрофами. Обитают только в аэробных условиях. При неблагоприятных условиях превращаются в спору.

__________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

Задание 22. Выберите правильные утверждения:

а) бактерии размножаются спорами;
б) бактериальная клетка не имеет аппарата Гольджи;
в) для бактерий благоприятными условиями являются высокая температура и ультрафиолетовое излучение;
г) к прокариотам относятся простейшие, водоросли и грибы;
д) прокариоты широко используются в различных отраслях народного хозяйства;
е) среди прокариот встречаются как автотрофы, так и гетеротрофы;
ж) бактерии живут только в анаэробных условиях;
з) серобактерии относятся к хемотрофам;
и) прокариоты способны активно передвигаться;
к) все бактерии – паразиты животных и растений.

______________________________________________________________________________________________________________

Задание 23. Ответьте на тестовые вопросы:

1. Для прокариот характерны:

а) кольцевая молекула ДНК;
б) митохондрии, центриоли, аппарат Гольджи;
в) развитая система вакуолей;
г) оформленное ядро.

_______________________________

2. Бактерии размножаются:

а) половым способом;
б) вегетативно;
в) делением;
г) спорами.

_______________________________

3. Прокариоты для получения энергии используют:

а) свет;
б) готовые органические вещества;
в) окисление неорганических веществ;
г) все перечисленные способы.

_______________________________

4. К прокариотам относятся:

а) цианобактерии;
б) грибы;
в) простейшие;
г) губки.

______________________________

5. Основателем микробиологии считается:

а) Ч.Дарвин;
б) К.Линней;
в) Л.Пастер;
г) И.Мечников.

_____________________________

Вирусы.

Задание 24. Ответьте на вопросы:

Кем и когда были открыты вирусы?

______________________________________________________________________________________________________________

На каком этапе эволюции появились вирусы?

______________________________________________________________________________________________________________

Укажите последовательность возникновения в процессе эволюции: эукариоты, доклеточные структуры, вирусы, прокариоты.

______________________________________________________________________________________________________________

Почему наличие нуклеиновой кислоты не обеспечивает размножение вирусов?

______________________________________________________________________________________________________________

Задание 25. Расположите в правильном порядке последовательность событий заражения клетки вирусом.

1. ДНК вируса блокирует ДНК клетки-хозяина.
2. Вирус прикрепляется к наружной мембране клетки-хозяина.
3. Новые частицы вируса разрывают клетку-хозяина и инфицируют другие клетки.
4. На матрице ДНК вируса клетка начинает сбор белков вируса.
5. Мембрана клетки-хозяина растворяется под действием ферментов вируса, и внутри клетки-хозяина оказывается ДНК вируса.
6. ДНК вируса самореплицируется.
7. В результате самосборки образуются новые частицы вируса.

_______________________________________________________

Обмен веществ и преобразование энергии в клетке.

1. Совокупность реакций биологического синтеза называют пластическим обменом, или?

_______________________________________________________

2. Комбинация трех нуклеотидов.

_______________________________________________________

3. Для того чтобы синтезировался белок, информация о последовательности аминокислот в его первичной структуре должна быть доставлена к рибосомам. Этот процесс содержит два этапа, назовите их.

______________________________________________________________________________________________________________

4. Какой процесс является противоположным синтезу?

_______________________________________________________

5. Из чего состоит молекула АТФ?

______________________________________________________________________________________________________________

6. Энергетический обмен обычно делят на три этапа, опишите их.

__________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

7. Что такое автотрофы, на какие их делят группы? Чем они отличаются друг от друга?

___________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

8. Что такое фотосинтез? Опишите его.

___________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

9. Что такое хемосинтез?

_____________________________________________________________________________________________________________________________________________________________________

10. К какой группе относят нитрифицирующие бактерии?

______________________________________________________________________________________________________________

11. Структура синтезируемых крупных органических молекул, синтез которых осуществляется белками-ферментами, определяется последовательностью нуклеотидов в ДНК, то есть

____________________________________________________________________________________________________________________________________________________________________

12. Что такое генетический код?

_____________________________________________________________________________________________________________________________________________________________________

13. Почему диссмиляцию называют энергетическим обменом клетки?

_____________________________________________________________________________________________________________________________________________________________________

Тема: «Организм. Размножение и индивидуальное развитие».

Задание 1. Опишите процесс возникновения нового организма при бесполом размножении.

Задание 2. Как осуществляется бесполое размножение у многоклеточных животных?

Задание 3. Установите соответствия между растениями и органами

размножения:

1.Картофель а. Усы

2.Жасмин б. Клубни

3.Земляника в. Листовые черенки

4.Бегония г. Черенок

Задание 4. Назовите пять типов бесполого размножения.

Вопросы с выбором одного правильного ответа:

Задание 5. Сколько особей участвует при бесполом размножении?

А) 1 особь

Б) 2 особи

Задание 6. Почкование – это:

А) половой способ размножения

Б) бесполый способ размножения

Задание 7. Вегетативное размножение – это:

А) половое размножение

Б) размножение спорами

В) размножение вегетативными органами растений

Задание 8. Какой ответ наиболее верен? Половое размножение — это такой тип размножения при котором. . .

А) организм развивается из двух половых клеток;

Б) происходит смена поколений и развитие организмов на основе специализированных половых клеток, образующихся в половых железах;

В) организм развивается при участии половых клеток двух разных особей;

Г) происходит развитие новой особи из одной половой клетки.

Задание 9. При каком виде размножения дочерний организм имеет наибольшее сходство с родительским?

А) половом
Б) семенном
В) бесполом
Г) с чередованием поколений

Задание 10. Какие клетки учувствуют в бесполом размножении?

А) Соматические клетки, размножающиеся митозом.

Б) Половые клетки (гаметы), полученные путем мейоза.

Задание 11. Какая форма бесполого размножения используется для размножения плодово-ягодных культур?
А) Фрагментация.
Б) Почкование.
В) Клонирование.
Г) Вегетативное размножение.
Д) Спорообразование.

Задание 12. Какая естественная форма бесполого размножения известна у человека?
А) Почкование.
Б) Клонирование.
В) Вегетативное размножение.
Г) Полиэмбриония.
Д) Бесполого размножения у человека не существует.

Задание 13. Характерные черты бесполого размножения:

А) участвует гермафродитная особь

Б) участвуют две особи

В) половые клетки не образуются

Г) зародыш развивается из зиготы

Задание 14. Сколько стадий в процессе образования половых клеток? Назовите их.

Задание 15. Назовите основные стадии мейоза.

Задание 16. Заполните таблицу:

Задание 17. Что представляет собой оплодотворение?

_______________________________________________________

Задание18. Перечислите способы полового размножения: _______________________________________________________

Вопросы с выбором одного правильного ответа:

Задание 19.  Какого периода развития половых клеток не существует?

А) период роста

Б) период созревания

В) период деления

Г) период размножения

Задание 20. При партеногенезе организм развивается из. …. .
А) зиготы
Б) вегетативной клетки
В) соматической клетки
Г) неоплодотворённой яйцеклетки

Задание 21.  Партеногенез характерен для. ….. . 
А) тлей
Б) червей
В) бактерий
Г) простейших

Задание 22. В половом размножении участвуют. . .
А) бластомеры
Б) гаметы
В) почки
Г) споры

Задание 23. Решите кроссворд.

1.Период, в котором мужские гаметы увеличиваются незначительно, зато женские – в сотни, тысячи и даже в миллионы раз.

2.Процесс слияния сперматозоида и яйцеклетки.

3.Совокупность питательных веществ, необходимых для питания развивающегося зародыша.

4.Кислота, обеспечивающая синтез белков на ранней стадии развития зародыша.

5.Период, состоящий в том, что каждая половая клетка получает одинарный, гаплоидный набор хромосом.

6.Период, в котором первичные половые клетки делятся путем митоза, в результате чего увеличивается их количество.

7.Будущие яйцеклетки.

8.Обмен участками между гомологичными хромосомами в процессе мейоза.

9.Оплодотворенная яйцеклетка имеющая диплоидный набор наследственной информации.

10.Клетки развивающиеся в женских половых железах.

11.Процесс точного, тесного сближения гомологичных хромосом в мейозе.

12.Процесс развития женских половых клеток.

13.Клетки развивающиеся в мужских половых железах.

14.Процесс развития мужских половых клеток.

Какие утверждения верны?

1. Размножение – характерное свойство всех живых организмов.

2. Цветок – вегетативный орган.

3. При бесполом размножении образуются половые клетки.

4. Почкование – способ бесполого размножения.

5. При бесполом размножении образуются одинаковые дочерние особи.

6. Дрожжи размножаются делением клеток.

7. Споры – это специальные образования для бесполого размножения, состоящие из нескольких клеток.

8. Спорами размножаются только мхи и грибы.

9. Вегетативное размножение – это размножение растений частями или вегетативными органами.

Проверь свои знания

1. Какое значение имеет размножение для животных?

______________________________________________________________________________________________________________

  1. Почему половое размножение – наиболее распространенный способ размножения живых организмов?

__________________________________________________________________________________________________________________________________________________________________

3. Как называются половые клетки?

4. Где образуются половые клетки?

______________________________________________________________________________________________________________

5. Чем яйцеклетки отличаются от сперматозоидов и почему?

_____________________________________________________________________________________________________________________________________________________________________

6. Какие животные называются раздельнополыми?

______________________________________________________________________________________________________________

7. Кто такие гермафродиты?

______________________________________________________________________________________________________________

8. В чем состоит сущность партеногенеза?

_____________________________________________________________________________________________________________________________________________________________________

9. Что такое оплодотворение?

______________________________________________________________________________________________________________

10. Для каких животных характерно наружное оплодотворение?

_____________________________________________________________________________________________________________________________________________________________________

«Онтогенез»

1. Какой русский ученый считается основателем современной эмбриологии?

________________________________________________

2.Что называют онтогенезом? На какие периоды он делится?

________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

3. Что называют бластомерами?

________________________________________________________________________________________________________________________________________________

4. Что происходит в период дробления?

________________________________________________________________________________________________________________________________________________

5. Что такое бластула?

________________________________________________________________________________________________________________________________________________

6. Зарисуйте расположение зародышевых листков у хордовых животных?


7. Из чего состоит зародыш на стадии гаструлы? Как называется совокупность процессов приводящих к образованию гаструлы? В чем сущность гаструляции?

________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

8. Что такое дифференцировка или дифференцирование?

________________________________________________________________________________________________________________________________________________

9. Каким может быть постэмбриональное развитие?

________________________________________________________________________________________________________________________________________________

10. Что такое эмбриональная дивергенция?

________________________________________________________________________________________________________________________________________________

11. Дайте определение стрессу и гомеостазу, как они связаны?

________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

12. Что такое регенерация? Приведите примеры.

________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

Тема: «Основы генетики и селекции»

Задание 1

Дайте определение термину генетика.

_____________________________________________________________________________________________________________________________________________________________________

Задание 2

Перечислите основные понятия генетики.

____________________________________________________________________________________________________________________________________________________________________________________________________________________________

Задание 3

Выберете 5 любых понятий из предыдущего задания и дайте им определение.

____________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

_______________________________________________________

Закономерности наследования признаков

Задание 1

Свойство организмов, которое является противоположным наследственности.

_____________________________________________________

Задание 2

На схеме представлен опыт Менделя. Какой закон представлен в этом опыте? Опишите опыт. Сформулируйте закон.

Задание 3

По данному рисунку объясните, в чем заключается неполное доминирование?

________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

Задание 4

Допишите предложения.

Скрещивание двух организмов это___________________. Совокупность всех генов, входящих в состав генотипов определенной группы особей или целого вида_____________________. Совокупность всех генов одного организма __________________. Преобладание у гибрида признака одного из родителей __________________. Скрещивание двух организмов отличающихся друг от друга по одному признаку________________________________________. Признак противоположный доминантному_______________________.

Задание 5

Заполните пропуски в схеме:

Задание 6

Как наследуются гены, локализованные в одной хромосоме?

______________________________________________________________________________________________________________

Задание 7

Заполните схему наследования гемофилии.

Задание 8

У человека ген полидактилии (многопалости) доминирует над нормальным строением кисти. У жены кисть нормальная, муж гетерозиготен по гену полидактилии. Определите вероятность рождения в этой семье многопалого ребенка.

______________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

Задание 9

Растение высокого роста подвергли опылению с гомозиготным организмом, имеющим нормальный рост стебля. В потомстве было получено 20 растений нормального роста и 10 растений высокого роста.

Какому расщеплению соответствует данное скрещивание – 3:1 или 1:1?

_______________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

Задание 10

Рецессивные гены (а) и (с) определяют проявление таких заболеваний у человека, как глухота и альбинизм. Их доминантные аллели контролируют наследование нормального слуха (А) и синтез пигмента меланина (С).

Гены не сцеплены.

Родители имеют нормальный слух; мать брюнетка, отец альбинос. Родились три однояйцовых близнеца больные по двум признакам.

Какова вероятность того, что следующий ребёнок в этой семье будет иметь оба заболевания?

_____________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

Задание 11

В каком ряду написаны формулы особей только с гомозиготными признаками.

А) Аа, ВВ, Вв.

Б) АА, Вв, ВВ.

В) АА, ВВ, вв.

Г) Аа, ВВ, вв.

Задание 15

Как обозначаются особи гомозиготные с доминантными признаками.

А) ААВВ

Б) ААВв

В) АаВВ

Закономерности изменчивости.

Задание 1

Найдите ошибки в тексте.

К наследственной изменчивости относят изменение признаков в организме, которые определяются фенотипом. Эти изменения не сохраняются в последующих поколениях. Такие изменения называются мутациями. Большинство мутаций рецессивные.

___________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

Задание 2

Генотип формируется под влиянием:

А) только условий внешней среды

Б) только генотипа

В) генотипа и условий внешней среды

Г) только в результате деятельности человека

Задание 3

Отметьте верные и неверные утверждения.

— Мутации возникающие в соматических клетках называют генеративными.

— Мутации возникают внезапно и действуют ненаправленно

— К мутациям относят изменения кариотипа

— Мутации не могут нести пользы.

Селекция растений, животных и микроорганизмов

Задание 1

Селекция процесс:

А) Одомашнивания животных.

Б) Выведения новых и улучшение существующих растений и пород животных

В) Изменение живых организмов, осуществляемый человеком для своих потребностей.

Г) Улучшения многообразия и происхождения культурных растений.

Задание 2

Дайте определения терминам: сорт, порода, штамм.

_________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

Задание 3

Основным методом селекции является:

А) отбор

Б) скрещивание

В) размножение

Г) гибридизация

Задание 4

Назовите примеры применения микроорганизмов.

___________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

Задание 5

Приведите примеры сортов растений.

Тема: «Эволюционное учение»

Задание

решите кроссворд:

1.Французский естествоиспытатель создавший первую эволюционную теорию и предложивший термин «биология». Заложил основы естественной системы классификации.

2.Теория, положившая конец спорам приверженцев неизменности видов и стихийных эволюционистов.

3.В современной науке высшим таксоном стало…

4.Самый крупный таксон в системе Линнея.

5.Принцип «соподчиненности».

6.Прибор созданный в 17 веке и применяющийся в биологических исследованиях.

7.От греческого «расположение в порядке».

8.Теория отвечающая на возникновение сложных организмов, их приспособительные признаки, разнообразие органического мира и его сохранение в природе и другие вопросы.

9.Шведский естествоиспытатель описавший более 8000 видов растений, установивший единообразную терминологию и порядок описания видов.

10.«Двойная» номенклатура.

11.Древнегреческий философ, описавший более 500 видов различных растений и животных.

12.Совокупность особей, обладающих способностью к скрещиванию с образованием плодовитого потомства, проживающих на определённой территории.

13.Английский естествоиспытатель – создатель современной теории эволюции.

Теория Ч. Дарвина о происхождении видов путем естественного отбора

1. Образование новых видов под действием естественного отбора в процессе исторического развития.

2. Эволюционные процессы, протекающие внутри вида и ведущие к образованию новых видов, — начальный этап эволюции.

3. Эволюционный процесс образования из видов, возникших в результате микроэволюции.

4. Видообразование путём географической изоляции популяции – при расселении, распадении ареала.

5. Совокупность особей одного вида, занимающих определённый ареал, свободно скрещивающихся друг с другом, имеющих общее происхождение, генетическую основу и в той или иной степени изолированных от других популяций данного вида. Это элементарная эволюционная структура.

6. Английский естествоиспытатель. Создал теорию эволюции органического мира.

7. Относительная целесообразность строения и функций организма, явившаяся результатом естественного отбора.

8. Способность организмов изменять свои признаки и свойства.

9. Способность организмов передавать следующему поколению свои признаки и свойства.

10. Результат борьбы за существование.

11. Совокупность популяций особей, обладающих наследственным сходством морфологических, физиологических и биохимических особенностей, свободно скрещивающихся и дающих плодовитое потомство, приспособленных к сходным условиям жизни и занимающих в природе определённую область распространения — ареал.

12. Процесс исторического развития живой природы на основе изменчивости, наследственности и естественного отбора.

13. Расхождение признаков в пределах популяции, вида, возникающее под действием естественного отбора.

14. Образование нового вида путём освоения популяцией нового местообитания в пределах ареала данного вида.

15. Сближение признаков в пределах разных систематических групп живых организмов, возникших при воздействии относительно одинаковых условий существования в ходе естественного отбора.

16. Совокупность генов популяции в данный период времени.

17. Разработанная Ч. Дарвином теория эволюции органического мира на Земле путём естественного происхождения видов на основе изменчивости, наследственности, борьбы за существование и отбора.

Приспособленность организмов к условиям внешней среды

1.Поза животного в случае опасности, не обладающего средствами активной защиты.

2.Внешнее сходство незащищенных животных, с предметами окружающей среды и растениями или несъедобными, или защищенными животными.

3.Реально существующая, генетически неделимая единица органического мира.

4.Сокол, пикирующий на свою жертву со скоростью до 290 км/час.

5.Приспособленность организмов к условиям внешней среды.

6.Одинаковый хромосомный набор особей одного вида.

7.Поведение организма необходимое в борьбе за существование.

8.Элементарная единица эволюции.

9.Французский естествоиспытатель.

10.Область распространения вида.

11.Яркая окраска тела, которая заранее предостерегает хищника о бесполезности и опасности нападения.

12.Форма тела дельфина, благодаря которой не образуются тормозящие движения, завихрения потоков воды.

13. Форма тела этой морской рыбки похожа на водоросль.

14.Форма тела, способствующая быстрому передвижению животных в воздушной среде.

15.Тело этой рыбки уплощено в спинно-брюшном направлении, т.к. животное ведет глубоководный образ жизни.

16.Рыбка, вынашивающая икру во рту.

17.Окраска тела, благодаря которой животное сливается с окружающим фоном.

Вид, его критерии и структура.

Задание1.

1.Совокупность особей, сходных по строению, имеющих общее происхождение, свободно скрещивающихся между собой и дающих плодовитое потомство, называются…

А. Популяцией

Б. Видом

В. Классом

Г. Верного ответа нет

2.Различают…структуру популяции

А. Половую

Б. Возрастную

В. Генетическую

Г. Все ответы верны

3.Если в популяции преобладает пререпродуктивные особи, численность популяции будет…

А. Растущей

Б. Стабильной

В. Убывающей

Г. Верного ответа нет

4.Основой существования вида как генетической единицы живой природы является его…

А. Пострепродуктивная изоляция

Б. Пререпродуктивная изоляция

В. Репродуктивная изоляция

Г. Верного ответа нет

5.Для видов обитающих в Байкале, ареал ограничивается этим озером, — это пример … критерия

А. Экологического

Б. Морфологического

В. Географического

Г. Физиологического

6.Постоянно действующий источник наследственной изменчивости – это…

А. Миграции

Б. Мутационный процесс

В. Изоляция

Г. Верного ответа нет

7. Степень подвижности особей выражается расстоянием, на которое может перемещаться животное, — это расстояние называется…

А. Радиусом индивидуальной активности

Б. Миграцией

В. Изоляцией

Г. Верного ответа нет

8.Новые сочетания генов … выживаемость особей внутри вида

А. Понижают

Б. Повышают

В. Оставляют стабильной

Г. Верного ответа нет

9.Критений вида, включающий в себя совокупность факторов внешней среды, составляющих непосредственную среду обитания вида, — это … критерий

А. Экологический

Б. Географический

В. Морфологический

Г. Верного ответа нет

Задание2.

1.Реально существующая, генетически неделимая единица органического мира, — это…

А. Популяция

Б. Особь

В. Вид

Г. Класс

2.Различают … возрастной класс популяции

А. Пострепродуктивный

Б. Пререпродуктивный

В. Репродуктивный

Г. Все ответы верны

3.Подавляющее большинство видов живых организмов состоит из отдельных…

А. Популяций

Б. Особей

В. Организмов

Г. Верного ответа нет

4.Если в популяции преобладают репродуктивные особи, численность популяции будет…

А. Растущей

Б. Сокращающейся

В. Стабильной

Г. Верного ответа нет

5.Часто скрещиваются между собой виды тополей и ив, — это пример не абсолютности … критерия

А. Генетического

Б. Биохимического

В. Физиологического

Г. Морфологического

6.У растений радиус индивидуальной активности определяется расстоянием, на которое распространяется…

А. Пыльца

Б. Семена

В. Вегетативные части, способные дать начало новому растению

Г. Все ответы верны

7.Основополагающим для вида критерием является…

А. Морфологический

Б. Генетический

В. Физиологический

Г. Биохимический

8.Для разделения вида необходимо использовать

А. Морфологический и генетический критерии

Б. Биохимический и физиологический критерии

В. Географический и экологический критерий

Г. Все ответы верны

9.Критерий вида, в основе которого лежит сходство внешнего и внутреннего строения особи одного вида, — это …

А. Географический критерий

Б. Экологический критерий

В. Морфологический критерий

Г. Физиологический критерий

Задание3.

1.Совокупность географически и экологически близких популяций, способных скрещиваться между собой, обладающих общими морфо-физиологическими признаками, — это…

А. Вид

Б. Особь

В. Популяция

Г. Класс

2.Элементарной эволюционной единицей является…

А. Вид

Б. Особь

В. Популяция

Г. Верного ответа нет

3.В природных условиях популяции не смешиваются друг с другом. Этому препятствуют…

А. Географические преграды

Б. Морфологические отличия

В. Разные сроки размножения

4.Источник резерва наследственной изменчивости популяций, — это…

А. Миграции

Б. Изоляции

В. Мутационный процесс

Г. Верного ответа нет

5.Болотная камышовка и тростниковая камышовка внешне не отличаются, но не скрещиваются и имеют совершенно разные брачные песни, — это пример не абсолютности …

А. Морфологического критерия

Б. Экологического критерия

В. Географического критерия

Г. Биохимического критерия

6.Большой вклад в популяционную генетику внёс учёный…

А. Н.А. Северцов

Б. С.С. Четвериков

В. К.Ф. Рулье

Г. Д. Дидро

7.Концепция вида в целом не абсолютна, существуют организмы, которые вид не образуют, потому что…

А. Не завершёно видообразование, когда статус вида ещё не определён

Б. В палеонтологии близкие виды разделить невозможно

В. Особи с бесполым размножением, размножающиеся партеногенезом, самооплодотворяются

Г. Все ответы верны

8.Генофонд вида представлен …

А. Генофондами особей

Б. Генофондами популяций

В. Генофондами отдельных организмов

Г. Все ответы верны

9.Критерий, характеризующий определённый ареал, занимаемый видом в природе, — это…

А. Экологический критерий

Б. Морфологический критерий

В. Географический критерий

Г. Физиологический критерий

Задание 4.

1. Физиологический критерий вида проявляется в том, что у всех его особей:

а) наблюдается сходство всех процессов жизнедеятельно­сти;

б) определенный набор и форма хромосом;

в) наблюдается сходство химического состава;

г) имеется сходство внешнего и внутреннего строения.

2. Относительность морфологического критерия вида состо­ит в том, что:

а) ареалы разных видов совпадают;

б) наборы хромосом у разных видов одинаковые;

в) самцы и самки одного вида различаются внешне;

г) разные виды обитают в сходных условиях.

3. При определении принадлежности организма к тому или иному виду необходимо учитывать:

а) комплекс критериев вида;

б) знания о входящих в него популяциях;

в) к какому роду принадлежит вид;

г) историю развития вида.

4. Особей в одну популяцию объединяет:

а) изоляция;

б) общность питания;

в) наличие хищников;

г) свободное скрещивание.

5. Приспособленность вида к жизни в разных условиях в пределах своего ареала обеспечивает его существование в форме:

а) популяций;

б) отдельных особей;

в) колоний;

г) сообществ.

6. Морфологический критерий вида:

а) область распространения вида;

б) особенности процессов жизнедеятельности;

в) особенности внешнего и внутреннего строения;

г) определенный набор хромосом и генов.

7. Для определения вида недостаточно использовать только
морфологический критерий, так как:

а) существуют виды-двойники;

б) виды разделены на популяции;

в) близкие виды могут занимать один ареал;

г) близкие виды могут занимать разные ареалы.

8. Диплоидный набор хромосом — это критерий вида:

а) морфологический;

б) биохимический;

в) генетический;

г) физиологический.

9. Элементарной единицей существования и адаптации вида является:

а) особь;

б) популяция;

в) подвид;

г) сорт.

10. Наследственная изменчивость, борьба за существование, естественный отбор проявляются в популяции, поэтому ее счи­тают:

а) структурной единицей вида;

б) единицей экосистемы;
в) компонентом биосферы;
г) единицей эволюции.

Микроэволюция» и «Макроэволюция.

Задание1.

1.Кто в своих трудах писал о том, что человек и животные имеют единый план творения?

А. Гераклит

Б. Аристотель

В. Линней

Г. Анаксимен

2.В средние века в науке господствовали …

А. Метафизические взгляды

Б. Трансформизм

В. Креационизм

Г. Верного ответа нет

3.Первая эволюционная теория была разработана

А. В 1809

Б. В 1859

В. В 1897

Г. В 1976

4.Выведением новых сортов и пород растений и животных занимается…

А. Селекция

Б. Генетика

В. Физиология

Г. Цитология

5.Все новые признаки возникают в результате…

А. Комбинативной изменчивости

Б. Наследственности

В. Мутационной изменчивости

Г. Верного ответа нет

6.Какая из видов борьбы за существование происходит наиболее остро?

А. Межвидовая борьба

Б. Борьба с неблагоприятными условиями

В. Внутривидовая борьба

Г. Верного ответа нет

7.Закон стабилизирующего скрещивания установил…

А. Шмальгаузен

Б. Мюллер

В. Северцов

Г. Пирсон

8.Сходство между незащищёнными и защищёнными видами – это…

А. Демонстрационная окраска

Б. Маскировка

В. Мимикрия

Г. Все ответы верны

9.Морфофизиологический процесс, который ведёт к упрощению организмов, к морфофизиологическому регрессу – это…

А. Идиоадаптация

Б. Общая дегенерация

В. Ароморфоз

Г. Верного ответа нет

10.Назовите социальный фактор антропогенеза:

А. Общественный образ жизни

Б. Развитие речи

В. Развитие мышления

Г. Все ответы верны

Задание2.

1.Первым эволюционную теорию предложил…

А. Уоллес

Б. Дарвин

В. Линней

Г. Ламарк

2.Кто из учёных разделил всю живую природу на два царства?

А. Ламарк

Б. Дарвин

В. Северцов

Г. Линней

3.О главной движущей силе эволюции в своём гениальном труде Дарвин писал в…

А. 1987

Б. 1859

В. 1895

Г. 1867

4.Теория Дарвина объясняет появление приспособленности…

А. Комбинативной изменчивостью и естественным отбором

Б. Комбинативной изменчивостью и искусственным отбором

В. Мутационной изменчивостью и искусственным отбором

Г. Мутационной изменчивостью и естественным отбором

5.Направленное изменение частоты встречаемости отдельных генов – это…

А. Волны жизни

Б. Дрейф генов

В. Популяционные волны

Г. Изоляция

6.Конвергенция – это…

А. Схождение признаков

Б. Расхождение признаков

В. Преобразование строения и функций организма

Г. Верного ответа нет

7.Общими предками человека и человекообразных обезьян жили…

А. В мезозое

Б. В палеозое

В. В кайнозое

Г. Верного ответа нет

8.К агроценозам относят…

А. Луг

Б. Опушку леса

В. Мелководную речку

Г. Верного ответа нет

9.Назовите косное вещество:

А. Почва

Б. Газ

В. Микроорганизмы

Г. Метеориты

10.Частное приспособление организмов к определённому образу жизни в конкретных условиях внешней среды – это…

А. Ароморфоз

Б. Дивергенция

В. Мимикрия

Г. Верного ответа нет

Задание3.

1.Кювье придерживался…

А. Взглядов креационизма

Б. Взглядов трансформизма

В. Метафизических взглядов

Г. Верного ответа нет

2.В селекции растений часто получают полиплоидные формы. В основе полиплоидии лежит:

А. Удвоение хромосом

Б. Слияние ядер клеток

В. Нарушение процесса деления

Г. Все ответы верны

3.Некоторые безобидные неядовитые змеи приобрели значительное сходство с ядовитыми, что помогает им избегать нападения хищников, — такое явление получило название…

А. Мимикрия

Б. Маскировка

В. Демонстрационная окраска

Г. Верного ответа нет

4.Биогенетический закон сформулировали:

А. Мюллер и Геккель

Б. Северцов и Шмальгаузен

В. Харди и Вайнберг

Г. Верного ответа нет

5.Недоразвитые органы, которые утратили своё значение в процессе эволюции – это…

А. Ароморфозы

Б. Атавизмы

В. Идиоадаптации

Г. Верного ответа нет

6.Среди семенных наиболее развиты покрытосеменные. Их ароморфозы выражаются в…

А. Появлении специального органа размножения – цветка

Б. Защите семени

В. Развитии двойного оплодотворения

Г. Все ответы верны

7.Общими предками орангутангов, гиббонов и человекообразных обезьян были…

А. Проплиопитеки

Б. Дриопитеки

В. Парапитеки

Г. Неоантропы

8.В каком периоде кайнозойской эры от насекомоядных плацентарных отделилась ветвь, которая затем привела к появлению парапитеков?

А. Палеогеновый период

Б. Неогеновый период

В. Антропогеновый период

Г. Верного ответа нет

9.Главным веществом биосферы, по определению Вернадского, является…

А. Косное вещество

Б. Биогенное вещество

В. Живое вещество

Г. Биокосное вещество

10.Назовите биологические факторы эволюции:

А. Трудовая деятельность

Б. Наследственная изменчивость

В. Дрейф генов

Г. Популяционные волны

Д. Общественный образ жизни

Е. Развитие речи

Ж. Изоляция

З. Развитие мышления

Тема: «История развития жизни на Земле»

Задание1.

1. Наша планета сформировалась около…

  1. 5 млрд лет назад

  2. 4,6 млрд лет назад

  3. 50 млн лет назад

  4. 100 млн лет назад

2. Первыми фотосинтезирующими организмами были:

  1. цианеи

  2. зеленые водоросли

  3. сине-селеные водоросли

  4. губки

3. На границе архейской и протерозойской эры произошло два крупных эволюционных события:

  1. крупные ароморфозы у двух подклассов пресмыкающихся

  2. внутреннее оплодотворение и накопление желтка в яйцеклетке

  3. появление псилофитов и членистоногих

  4. появился половой процесс и многоклеточность

4. Что позволяет сохранять мутации в гетерозиготном состоянии

  1. гаплоидность

  2. диплоидность

  3. половой процесс

  4. создание бесчисленных комбинаций в хромосомах

5. Когда появляются первые наземные растения – псилофиты?

  1. в конце палеозойской эры

  2. в начале палеозойской эры

  3. в протерозойской эре

  4. в мезозойской эре

6. Голосеменные растения появляются:

  1. в палеозойской эре

  2. в протерозойской эре

  3. в мезозойской эре

  4. в кайнозойской эре

7. Кистеперые рыбы были:

  1. типично водные животные

  2. типично наземные животные

  3. могли обитать и в воде, и на суше

  4. могли пережидать неблагоприятные условия, зарываясь в ил

8. Кистеперые рыбы дали начало:

  1. двоякодышащим рыбам

  2. стегоцефалам

  3. трилобитам

  4. лучеперым рыбам

9. Палеозойская эра характеризуется появлением большинства представителей типа хородовых:

  1. птиц, млекопитающих

  2. насекомых, рептилий

  3. пресмыкающихся

  4. рыб, амфибий, рептилий

10. Первые покрытосеменные растения появляются

  1. в палеозойской эре

  2. в протерозойской эре

  3. в мезозойской эре

  4. в кайнозойской эре

11. Птицы произошли от:

  1. рептилий-архозавров

  2. стегоцефалов

  3. летающих ящеров

  4. хищных динозавров

12. Возникновение птиц сопровождалось появлением крупных ароморфозов в строении их предков:

  1. перьевой покров и появление клюва

  2. воздушные мешки и двойное дыхание

  3. укорочение задней кишки

  4. приобрели полную перегородку между правым и левым желудочками сердца

13. Первые хищные и приматы произошли от:

  1. примитивных насекомоядных млекопитающих

  2. рептилий-архозавров

  3. подкласса однопроходные

  4. от звероподобных рептилий

14. Предками голосеменных растений были:

  1. цианеи

  2. зеленые водоросли

  3. семенные папоротники

  4. псилофиты

15. Какие свойства позволили рептилиям окончательно порвать связь с водной средой?

  1. внутреннее оплодотворение и накопление желтка в яйцеклетке

  2. ороговение кожи и сложное строение почки

  3. появление грудной клетки и хорошо развитые конечности

  4. отсутствие конкуренции

16. Первые живые организмы, возникшие в архейской эре, были:

  1. фотосинтезирующими

  2. гетеротрофами

  3. хемотрофами

  4. фотосинтезирующими и гетеротрофами

Задание2.

1.Ответьте, правильное ли высказывание (да или нет)

1.Первыми растениями на суше были псилофиты.

2.Рептилии произошли от млекопитающих

3.В архейской эре появились все типы животных.

4.Млекопитающие появились в палеозое.

5.Первыми семенными растениями были плауны.

2.Выбрать правильный ответ.

1.Первые живые организмы на Земле появились:

А)в протерозое Б)в палеозое В)в архее Г)в мезозое

2.Какой период не относится к мезозойской эре?

А) триас Б) карбон В) мел В) юра

3.Птицы произошли:

А) от млекопитающих Б) от рептилий В) от земноводных Г)от рыб

4.Покрытосеменные растения на Земле появились:

А) в кайнозое Б) в палеозое В) в протерозое Г) в мезозое

5.Голосеменные произошли:

А) от мхов Б) от плаунов В) от папоротников Г) от хвощей

3.Расположите группы животных в порядке их возникновения:

а)плоские черви б)хордовые в) кишечнополостные г)жгутиковые д)трилобиты.

4. Дописать предложения.

а)Концепция постоянства видов, рассматривающая многообразие органического как результат его творения высшим существом……….

б) Эмпирическое обобщение, утверждающее, что все живое происходит от живого,- ….

в) Самые древние на Земле окаменелые продукты жизнедеятельности цианобактерий, найденные в виде известковых корок в архейских породах…………

г) Эра в истории Земли, название которой переводится с греческого как «древняя жизнь», -…….

д) Класс вымерших морских членистоногих, достигших расцвета в конце кембрия и ордовике, но вымерших к концу палеозоя, -……….

е) Первым периодом, когда растения начали заселять сушу, был……

ж) Переходной формой между древними кистеперыми рыбами и земноводными, появившейся в конце девона и жившие до начала юры, были……..

з) Гипотетический суперконтинент, объединяющий в палеозое и начале мезозоя все современные материки, -……..

и) Расцвет земноводных приходится на……………..период……………эры

к) Переходная форма между пресмыкающимися и птицами, обнаруженная на территории Баварии, -…….

5.Назовите эры в хронологическом порядке.

Задание3.

1.Ответьте, правильное ли высказывание (да – нет)

1.Первыми растениями на суше были голосеменные растения.

2.Рептилии произошли от земноводных.

3.В палеозойской эре появились все типы животных.

4.Птицы появились в протерозое.

5.Первыми семенными растениями были хвощи.

2.Выбрать правильный ответ.

1.Беспозвоночные животные появились:

А) в протерозое Б)в палеозое В) в архее Г) в мезозое

2.Какой период относится к мезозойской эре:

А) пермь Б) карбон В) мел Г) девон

3.Млекопитающие произошли:

А) от бесчерепных Б) от рептилий В) от земноводных Г) от рыб.

4.Папоротники на Земле появились:

А) в кайнозое Б) в палеозое В) в протерозое Г) в мезозое

5.Покрытосеменные произошли:

А) от мхов Б) от голосеменных В) от папоротников Г) от водорослей

3.Расположите группы растений в порядке их возникновения.

а)покрытосеменные б)псилофиты в)папоротники г) голосеменные д) водоросли

4.Дописать предложения.

а)Гипотеза занесения жизни на Землю из космоса, -……..

б) Самопроизвольно концентрирующийся в виде капелек коллоидный раствор первичных органических веществ, синтезированных абиогенным путем из неорганических, -….

в) Основная единица геологического летоисчисления, отражающая большие по протяженности этапы в развитии Земли……

г) Самая длинная по времени единица геологического летоисчисления, предшествовавшая палеозою, -……..

д) Наука о живых организмах прошлых геологических эпох, изучаемых по ископаемым остаткам и следам жизнедеятельности, -………..

е) Эра в истории Земли, название которой переводится с греческого как «древнейший»,-…

ж) Первым периодом, когда растения начали заселять сушу, был, -….

З) Первыми наземными сосудистыми растениями, у которых еще отсутствовало деление на корни, стебель и листья были, -……

и) Период палеозоя, когда на суше появились настоящие леса из древовидных споровых, а в морях наблюдалось разнообразие рыб, был -……..

к) Эра расцвета покрытосеменных, насекомых, птиц и млекопитающих, -…….

5.Назовите по порядку периоды палеозойской эры.

Тема: «Происхождение человека».

Задание1. Для человека характерны признаки типа хордовых:

1.теплокровность

2. наличие позвоночного столба и две пары конечностей

3. развитие плода в теле матери

Задание 2. О принадлежности человека к классу млекопитающих свидетельствуют…

1.четырехкамерное сердце; млечные железы и развитая кора головного мозга

2. конечности хватательного типа

3. третье веко

Задание3. Доказательством родства человека с обезъянами служат следующие факты:

        1. их скелеты одинаковы

        2. родственные группы крови

3. нет правильного ответа

Задание4. Антропогенез — процесс…

  1. исторического развития живой природы

  2. индивидуального развития человека

  3. волюционно-исторического формирования человека

Задание5. К биологическим движущим силам антропогенеза относят…

  1. наследственность и изменчивость

  2. речь

  3. воспитание

Задание 6. У представителей всех рас имеются общие признаки, доказывающие их принадлежность к одному виду:

  1. высокоразвитый мозг и способность к творческой деятельности

  2. развитая речь и способность к трудовой деятельности

  3. оба ответа верны

Задание 7 .Социальными движущими силами антропогенеза явились…

  1. труд и образование

  2. борьба за существование

  3. естественный отбор

Задание 8. Человеком современного типа считают…

  1. неандертальца

  2. кроманьонца

  3. синантропа

Задание 9 . Ведущую роль в эволюции человека играют…

  1. только социальные факторы

  2. только биологические законы

  3. социальные факторы и биологические законы

Задание10. Главный признак отделивший человека от приматов…

  1. прямохождение

  2. труд

  3. использование огня

Задание11. Общими предками человека и человекообразных обезъян были…

  1. дриопитеки

  2. питекантропы

  3. австралопитек

Задание 12. Где были обнаружены остатки австралопитеков?

  1. в центральной Европе

  2. в Китае

  3. в Южной Африке

Задание 13. Укажите гомолог руки человека:

  1. ласт кита

  2. крыло бабочки

  3. клешня рака

Задание 14. Человеческие расы — это…

  1. нация

  2. языковая группа

  3. группы популяций людей

Задание 15. Кроманьонцы — это…

  1. первые люди современного вида

  2. высшие ископаемые приматы

  3. вымершие человекообразные обезьяны

Тема: «Основы экологии»

Задание1.

1. Наука о закономерностях взаимоотношений организмов, видов, сообществ со средой обитания.

2. Временное состояние организма, при котором жизненные процессы замедленны до минимума и отсутствуют все видимые признаки жизни.

3. Приспособление животных к перенесению зимнего времени года.

4. Потребность организмов в периодической смене определённой продолжительности дня и ночи.

5. Фактор, где идёт непосредственное воздействие человека на организмы или воздействия им через изменение среды обитания.

6. Граница выносливос

Рабочая тетрадь по Биологии 10 класс Пасечник Швецов 2013

 

Рабочая тетрадь по Биологии 10 класс Пасечник Швецов 2013

Предмет biolog: окружающий мир
Год выхода: 2015-2017
Формат решебника (гдз): скрин, фото
Тип: Правильные ответы
В тетради страниц: много
Класс: 10

Читать тетрадь — решебник по биологии онлайн, выбираем страницы:

 Авторы: Пасечник В.В., Швецов Г.Г.
Класс: 10
Предмет: Биология

 

Готовые задания Тема 1.1. Краткая история развития биологии. Методы исследования в биологии. 1 2 3 4 5 6 7 8 9
Методы исследования в биологии.
1 2 3 4 5 6 7 8
Тема 1.2. Сущность жизни и свойства живого. Уровни организации живой материи. Биологические системы. 1 2 3 4 5
Уровни организации живой материи.
1 2 3
Тема 2.1. Методы цитологии. Клеточная теория. 1 2 3 4 5
Тема 2.2. Химический состав клетки. 1 2 3
Неорганические вещества. Роль воды и минеральных веществ в жизнедеятельности клетки.
1 2 3 4 5 6
Органические вещества. Роль углеводов, липидов и белков в жизнедеятельности клетки.
1 2 3
Нуклеиновые кислоты, АТФ и другие органические соединения клетки.
1 2 3 4 5 6 7 8 9 10 11 12 13
Тема 2.3. Строение клетки. Строение клетки. Основные части и органоиды клетки, их строение и функции.
1 2 3 4 5 7
Эукариотические и прокариотические клетки. Строение и функции хромосом.
1 3 4 6
Сходства и различия в строении клеток животных, растений и грибов.
1 2 4
Тема 2.4. Реализация наследственной информации в клетке. 1 2 3 4 5 6
Тема 2.5. Вирусы. 1 2 3 4 5 6 7 8 9 10 11
Тема 3.1. Организм — единое целое. Многообразие организмов. 1 2 3 4
Тема 3.2. Обмен веществ и превращение энергии — свойство живых организмов. 1 2 3 4 5
Особенности обмена веществ у растений, животных и бактерий
1 2 3 4 5
Тема 3.3. Размножение. Размножение – свойство организмов. Деление клетки как основа роста, развития и размножения организмов
1 2 3 4 5 6 7 8
Бесполое размножение
1 2 3
Половое размножение. Мейоз
1 2 3 4 5 6 7 8
Оплодотворение и его значение
1 2 3 4
Тема 3.4. Индивидуальное развитие организма (онтогенез). Индивидуальное развитие организма (онтогенез). Причины нарушения онтогенеза
1 2 3 4 5 6 7 8 9
Индивидуальное развитие человека. Репродуктивное здоровье человека
1 2 3 4 5 6
Тема 3.5. Наследственность и изменчивость. Наследственность и изменчивость – свойства организмов. Генетика как наука
1 2 3 4 5 6 7
Закономерности наследования. Моногибридное скрещивание
1 2 3 4 5 6 7
Множественные аллели. Анализирующее скрещивание
1 2 3 4 5 6
Дигибридное скрещивание
1 2 3 4
Хромосомная теория наследственности. Современные представления о гене и геноме
1 2 3 4 5 6 7
Наследственная и ненаследственная изменчивость
1 2 3 4 5 6
Наследование признаков у человека. Наследственные болезни у человека
1 2 3 4 5
Тема 3.6. Генетика — теоретическая основа селекции. Селекция. Биотехнология. Генетика – теоретическая основа селекции. Селекция и ее методы
1 2 3 4 5
Учение Н. И. Вавилова о центрах многообразия и происхождения культурных растений
1 2 3
Биотехнология, ее достижения и перспективы развития
1 2 3 4
Тема 4.1. История эволюционных идей. История эволюционных идей. Значение работ К. Линней, учения Ж. Б. Ламарка
1 2 3 4 5
Эволюционное учение Ч. Дарвина
1 2 3 4 5 6
Борьба за существование и ее формы
1 2 3
Естественный отбор и его формы
1 2 3 4
Тема 4.2. Современное эволюционное учение. Вид и его критерии
1 2 3 4
Популяция – структурная единица вида и единица эволюции
1 2 3 4 5 6
Движущие силы эволюции и их влияние на генофонд популяции
1 2 3 4 5
Результаты эволюции
1 2 3 4 5
Биологический прогресс и биологический регресс
1 2 3 4 5
Синтетическая теория эволюции
1 2 3 4
Многообразие видов
1 2 3 4 5 6 7
Тема 4.3. Происхождение и развитие жизни на Земле. Гипотезы происхождения жизни на Земле
1 2 3 4
Основные этапы развития жизни на Земле
1 2 3
Усложнение живых организмов на Земле в процессе эволюции
1 2 3
Тема 4.4. Происхождение человека. Положение человека в системе животного мира
1 2 3 4 5
Основные стадии антропогенеза
1 2 3 4 5
Движущие силы антропогенеза
1 2 3 4 5 6 7
Происхождение человеческих рас
1 2 3 4 5 6
Тема 5.1. Экологические факторы. Экология как наука. Среда обитания организмов и ее факторы.
1 2 3 4 5 6 7 8
Экологические ниши и типы экологических взаимодействий
1 2 3 4
Конкурентные взаимодействия
1 2 3 4 5
Тема 5.2. Структура экосистем. Экологические сообщества. Видовая и пространственная структура экосистем.
1 2 3 4 5 6 7 8
Пищевые связи, круговорот веществ и превращение энергии в экосистемах
1 2 3 4 5 6 7 8 9
Причины устойчивости и смены экосистем
1 2 3 4 5 6
Тема 5.3. Биосфера – глобальная экосистема. Биосфера – глобальная экосистема. Учение В. И. Вернадского о биосфере.
1 2 3 4
Биологический круговорот. Эволюция биосферы
1 2 3 4
Тема 5.4. Биосфера и человек. Последствия деятельности человека в окружающей среде. Правила поведения в природной среде.
1 2 3 4 5 6
Глобальные экологические проблемы и пути их решения
1 2 3
Тренировочные задания (10-11 кл) Задания уровня A
Задания уровня B
Задания уровня С

— За что? — подозрительно спросил Пол.

— Потому что она является бывшим сотрудником полиции для постоянного любовника. Правильно это, он любит ее, даже возможно, что wzięliby.ślub, если бы не ее отвращение к браку. Вы знаете, это все же. Насколько я знаю, он уже оставил службу, но он делает консультант, и он все устроит молча.

— Это не плохая идея, — согласился Пол. — У вас есть место, чтобы спрятаться за это время?

— У меня есть. Официально, я живу в съемной комнате в одном лице на okotowska и там проживаю. И я действительно есть в вашем распоряжении квартира моей тети, моя тетя в Швеции и более раннего возвращения в течение двух лет, и я сомневаюсь, если вообще. На заседании дочери, мой двоюродный брат и диапазонам, или не вступать в брак, кажется, что ни один из кандидатов. Предпосылка чудо, Волк, три входа, проход через чердаки и не режущий, живет в соседнем доме. Собака с хромой ногой не спросил меня, что я могу пойти туда и спрятаться только в виде старушки. Даже с тростью, если вы хотите.

Рабочая тетрадь по Биологии 10 класс Пасечник Швецов

— Я хочу. Я боюсь за тебя, блин.

— Взаимно.

На скачках в изобилие южных народов жалости Дании сделали ни малейший интерес поминок. Павел заботился о ней, я решил сделать вдох и восстановить некоторый баланс, и не было лучше, чем лошади.

У меня было очень мало денег. Первые три гонки вылетел снисходительно, я пошел с ними к нулю, потому что я нашел случайность яму и посадил в пятом. 17 лошадей и ярусы. Я вышел, что восемь должны быть третьим, чтобы выбрать первые два.

Я стал интересоваться в гонках десять лет назад, моя свекровь. Если бы блестящие идеи, но неудача в игре, родилась в апреле, по сообщениям kwietniowi вы всегда проиграете. Я был в лучшем положении, чем она родилась в январе, и я случайно выиграть, но это не имело большого значения, потому что отказ от страсти наполнили меня счастьем, независимо от результата. Конь бежал гонку с пятого на трассе, я обследовал его, семью Rangers, эти Rangery всегда хорошие лошади. У него было два месяца перерыв, он пошел в первый раз, пять, и красиво łupał копыт бросали задние ноги, представляя ни малейшей тенденции к галоп. Кобыла вообще. И если это так в первую очередь это Christine Ranger.

Рабочая тетрадь Пасечник Швецов

— Смотри, шлюха, Дефо дно, с короткой мордой! — сказал кто-то рядом, и на мгновение мне показалось, что как-то так хорошо освоил датский язык. — У вас есть какие-либо идеи, сколько платить?

— А там, внизу! — фыркнул он пренебрежительно одну секунду. — Выбрасывайте мусор в ад, Оле говорит, что два должны быть в порядке. Все к ней.

— Первая игра, сосунок!

— Так дорого! Я играю в Стоу, я прикажу, чем вниз. В моих четыре приходит, мы играем два четыре?

— Как мы проиграем, то мы лжем мертвую бык. Мафиози не может трахать пенни до этого глупого не найти рашпилем. В картинах не было ничего.

— Вот где она без косточек? Больше ничего не было, только те чемоданы.

Я поблагодарил Бог за идею Ebony. Я стоял прямо там, не обратил ни малейшего внимания на меня. Я был в состоянии немного посмотреть на них, я узнал один, он пытался вырвать Kajtkowi багаж в аэропорту, возможно, в сопровождении других, но с другой стороны вряд ли смотрел. Они ищут меня очень хорошо, но я их нашел, он бы мог использовать.

Решебник по биологии за 10 класс С.Б. Данилов, А.И. Владимирская ФГОС

gdzguru.com Видеорешения решебники
  • 1 класс
    • Математика
    • Английский язык
    • Русский язык
    • Информатика
    • Музыка
    • Литература
    • Окружающий мир
    • Человек и мир
    • Технология
  • 2 класс
    • Математика
    • Английский язык
    • Русский язык
    • Немецкий язык
    • Белорусский язык
    • Французский язык
    • Информатика
    • Музыка
    • Литература
    • Окружающий мир
    • Человек и мир

Экзамен по биологии 10 класс

Ищете сертификационный экзамен, который поможет проверить ваши знания основ биологии и получить сертификат? StudySection запускает бесплатный онлайн-сертификационный экзамен по биологии (Foundation) для кандидатов, желающих проверить свои знания и опыт в области биологии, а также получить соответствующий сертификат. Бесплатный онлайн-сертификационный экзамен по биологии (Foundation) от StudySection — один из лучших доступных вариантов для получения сертификата, и этот сертификат признан во всем мире.В биологии мы изучаем структуру, функции, рост, происхождение, эволюцию и распространение живых существ. Он описывает функции видов, их существование и взаимодействия, которые они имеют друг с другом и с природной средой. Четыре объединяющих принципа составляют основу современной биологии: клеточная теория, эволюция, генетика и гомеостаз.

Биология была разработана как отдельная область в девятнадцатом веке, когда ученые обнаружили, что организмы имеют общие фундаментальные характеристики друг с другом, а также с природой.Биология в настоящее время является регулярным предметом обучения в школах и университетах по всему миру. Ежегодно в большом количестве публикуются миллионы статей по биологии. Прикладные области биологии, такие как медицина и генетические исследования, включают множество специализированных дисциплин.

Бесплатный онлайн-сертификационный экзамен по биологии (Foundation) от StudySection — это вопросы с несколькими вариантами ответов по основам биологии. Успешная сдача сертификационного экзамена StudySection даст вам право на получение электронного сертификата и значка сертификации, который может быть использован для отражения вашего опыта в области биологии.Кандидаты, которые хотят сдать этот онлайн-сертификационный экзамен от StudySection, могут пройти его, не выходя из дома или на рабочем месте.

Темы, которые будут рассмотрены на онлайн-сертификационном экзамене по биологии для 10-го класса, следующие:

  • Дискавери
  • Тип организма
  • Структура ячейки
  • Отделение клеток
  • Системы
  • Жизненные процессы
  • Контроль и координация
  • Репродукция
  • Наследственность и эволюция
  • Продовольствие и производство пищевых продуктов

Планы уроков биологии / естествознания в десятом классе, домашние задания, викторины

Планы уроков биологии / естествознания в десятом классе, домашние задания, викторины

Десятый класс биологии / естествознания

    • Девятый класс
      Десятый класс еще 1…, Десятый класс
    • 13,183 Просмотры

    Как работают ученые

    Тиффани Бут

    Место нахождения: Наука как исследование

    Задача: Студенты смогут разработать эксперимент, следуя этапам научного метода.

    • Восьмой класс
      Девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу. Еще 5 …, девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу.
    • 7,911 Просмотры

    «Я» в эволюции: биологическая индивидуальность

    Анке аль-Батаина из подготовительной школы для руководителей

    Место проведения: I vs.Мы: Индивидуализм и коллективизм, Продай свое мировоззрение

    Цель: Учащиеся понимают, как генетические вариации приводят к индивидуальности внутри популяций.

    • Восьмой класс
      Девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу. Еще 5 …, девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу.
    • Восьмой класс
      Девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу.Еще 5 …, девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу.
    • 2,625 Просмотры

    Как «продать» мировоззрение

    Анке аль-Батаина из подготовительной школы для руководителей

    Место проведения: I vs.Мы: Индивидуализм и коллективизм, Продай свое мировоззрение

    Цель: Учащиеся используют модели из корпоративного, политического и межличностного мира, чтобы развить убедительный «шаг» к индивидуализму или коллективизму.

    • Восьмой класс
      Девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу. Еще 5 …, девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу.
  • Плакат по безопасности, проект

    Тиффани Бут

    Место нахождения: Наука как исследование

    Цель: Студенты смогут определять символы безопасности и их значения в лаборатории.

    • Шестой класс
      Седьмой класс, Восьмой класс, Девятый класс, Десятый класс, Одиннадцатый класс, Двенадцатый класс Еще 6…, Седьмой класс, Восьмой класс, Девятый класс, Десятый класс, Одиннадцатый класс, Двенадцатый класс
    • 1,252 Просмотры
    • 1 Любимый

    • Шестой класс
      Седьмой класс, Восьмой класс, Девятый класс, Десятый класс, Одиннадцатый класс, Двенадцатый класс Еще 6…, Седьмой класс, Восьмой класс, Девятый класс, Десятый класс, Одиннадцатый класс, Двенадцатый класс
    • Восьмой класс
      Девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу. Еще 5 …, девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу.
    • 3,852 Просмотры

    Гимн I: Индивидуализм

    Анке аль-Батаина из подготовительной школы для руководителей

    Место проведения: I vs.Мы: Индивидуализм и коллективизм, Продай свое мировоззрение

    Цель: Учащиеся прочитают и поймут графическую версию романа Айн Рэнд «Гимн», поместив ее в идеологический спектр и соотнося с концепцией о…

    • Восьмой класс
      Девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу. Еще 5 …, девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу.
  • Большая идея: Форма и функции нервных тканей определяются внутренними и внешними факторами.

    Ресурсы (14)

    Размышления (1)

    Избранное (26)

    • Шестой класс
      Седьмой класс, Восьмой класс, Девятый класс, Десятый класс, Одиннадцатый класс, Двенадцатый класс Еще 6…, Седьмой класс, Восьмой класс, Девятый класс, Десятый класс, Одиннадцатый класс, Двенадцатый класс
    • 906 Просмотры

    • Шестой класс
      Седьмой класс, Восьмой класс, Девятый класс, Десятый класс, Одиннадцатый класс, Двенадцатый класс Еще 6…, Седьмой класс, Восьмой класс, Девятый класс, Десятый класс, Одиннадцатый класс, Двенадцатый класс
    • Восьмой класс
      Девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу. Еще 5 …, девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу.
    • 1,643 Просмотры

    Гимн II: Индивидуализм

    Анке аль-Батаина из подготовительной школы для руководителей

    Место проведения: I vs.Мы: Индивидуализм и коллективизм, Продай свое мировоззрение

    Цель: Учащиеся понимают индивидуалистическую философию Айн Рэнд и анализируют ее на предмет реалистичности. Студенты понимают замысел автора при написании…

    • Восьмой класс
      Девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу. Еще 5 …, девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу.
    • Шестой класс
      Седьмой класс, Восьмой класс, Девятый класс, Десятый класс еще 4 …, Седьмой класс, Восьмой класс, Девятый класс, Десятый класс
    • 2,749 Просмотры

    Извлечение ДНК

    Брент Мэддин

    Местонахождение: 040 ДНК

    Цель: SWBAT объяснить, как они могут успешно извлекать ДНК из клеток.

    • Шестой класс
      Седьмой класс, Восьмой класс, Девятый класс, Десятый класс еще 4 …, Седьмой класс, Восьмой класс, Девятый класс, Десятый класс
  • Активность по конверсии метрики Dream House

    Тиффани Бут

    Место нахождения: Наука как исследование

    Цель: Студенты смогут использовать свои знания английского языка и метрических систем для проектирования дома своей мечты.

    • Восьмой класс
      Девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу. Еще 5 …, девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу.
    • 1,613 Просмотры

    «Мы» в эволюции: биологический коллективизм

    Анке аль-Батаина из подготовительной школы для руководителей

    Место проведения: I vs.Мы: Индивидуализм и коллективизм, Продай свое мировоззрение

    Цель: Учащиеся используют компьютерное моделирование, чтобы понять факторы давления, вызывающие эволюцию популяций, и то, как мутации вписываются в эволюцию.

    • Восьмой класс
      Девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу. Еще 5 …, девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу.
    • Восьмой класс
      Девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу. Еще 5 …, девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу.
    • 1,734 Просмотры

    Оценки: I vs.Ср

    Анке аль-Батаина из подготовительной школы для руководителей

    Место: Я против Мы: Индивидуализм и коллективизм, Продай свое мировоззрение

    Задача: Студенты представляют выступление, плакат, короткий видеоролик или звукозапись (радиообъявление), которые убеждают людей принять мировоззрение индивидуализма или коллектива…

    • Восьмой класс
      Девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу.Еще 5 …, девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу.
    • Восьмой класс
      Девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу. Еще 5 …, девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу.
    • 1,298 Просмотры

    Джунгли I: Коллективизм

    Анке аль-Батаина из подготовительной школы для руководителей

    Место проведения: I vs.Мы: Индивидуализм и коллективизм, Продай свое мировоззрение

    Цель: Студенты прочитают и поймут «Джунгли» и сравнят его с индивидуалистической идеологией Айн Рэнд.

    • Восьмой класс
      Девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу. Еще 5 …, девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу.
    • Восьмой класс
      Девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу.Еще 5 …, девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу.
    • 1,342 Просмотры

    Я против Мы в истории и политике

    Анке аль-Батаина из подготовительной школы для руководителей

    Место проведения: I vs.Мы: Индивидуализм и коллективизм, Продай свое мировоззрение

    Цель: Студенты понимают, как индивидуалистические и коллективистские идеи влияют на историю, например, через Маркса и Локка, и влияют на текущую политику, например…

    • Восьмой класс
      Девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу. Еще 5 …, девятый класс, десятый класс, одиннадцатый класс, двенадцатый класс, подготовка к колледжу.

Что-то пошло не так. Смотрите подробности для получения дополнительной информации

Grade 9-1 GCSE Biology AQA Complete Revision & Practice with Online Edition

Приобретая название CGP Online Edition, вы получаете доступ к названию в течение трех лет с даты покупки.

Доступ к CGP Online Edition с использованием кода из печатной книги CGP предоставляет вам доступ к названию в течение трех лет с даты активации кода.

Используя CGP Online Edition или получая доступ к названию Online Edition, вы соглашаетесь с полными Условиями использования.

Пользователи CGP Online Editions

Вы можете:

  • Используйте CGP Online Editions в личных целях, включая учебу, обучение в классе, планирование уроков и обучение в школе.

Вы не можете:

  • Скопируйте любую часть CGP Online Editions (включая любой контент) в Интернет, на внутренний веб-сайт (интранет), в виртуальную среду обучения (VLE) или на любой другой компьютер.
  • Распечатать любую часть CGP Online Edition.
  • Поделитесь данными для входа в свою учетную запись с кем-либо еще или разместите информацию в Интернете.

Полные положения и условия

Это Соглашение о доступе к CGP Online Editions (Сервис).Сервис обеспечивает онлайн-доступ к ряду названий, опубликованных Coordination Group Publications Ltd. (CGP). Настоящее Соглашение распространяется на доступ к Сервису независимо от устройства или сети, через которую вы получаете к нему доступ. Используя Сервис, вы соглашаетесь соблюдать настоящее Соглашение.

Пожалуйста, ознакомьтесь с настоящим Соглашением, прежде чем добавлять новые книги в свою учетную запись CGP Online Editions (вашу учетную запись).

1. Лицензия

Принимая условия данного Соглашения, мы предоставляем вам неисключительную лицензию на доступ к названию CGP Online Edition на три года с даты покупки.

2. Разрешенное использование и ограничения

и. Вы можете получить доступ к Сервису и любым принадлежащим вам названиям на любом компьютере, который находится под вашим контролем.

ii. Вы можете использовать Сервис и любые названия для личного использования, включая, помимо прочего, учебу, обучение в классе, планирование уроков или обучение в школе.

iii. Вы не можете передавать какую-либо часть Сервиса или любой контент в рамках Сервиса в Интернет, на внутренний веб-сайт (интранет), Виртуальную среду обучения (VLE) или копировать его на любой другой компьютер.

iv. Вы не можете сублицензировать, переуступать, сдавать в аренду или передавать свои доступы.

3. Доступ к CGP Online Editions

i. Способы покупки

Вы можете приобрести доступ к определенному названию напрямую (Прямой доступ) или купив Код.

Прямой доступ используется для предоставления доступа к заголовку для вашего личного использования.

Коды

используются для передачи условий доступа другим пользователям. Школьные клиенты получат коды на распечатанных ваучерах, чтобы они могли предоставить учащимся доступ к названиям.

ii. Начало доступа

Доступ к определенному названию CGP Online Edition начинается с даты покупки.

iii. Прямой доступ

Приобретая и используя Прямой доступ, вы соглашаетесь с условиями настоящего Соглашения.

Прямой доступ нельзя перенести на другую учетную запись Online Editions.

iv. Коды

Код необходимо погасить, прежде чем можно будет получить доступ к названию, к которому он привязан.Невыкупленный Код может быть передан другому лицу или организации, которые затем могут его погасить.

Вы должны согласиться с условиями настоящего Соглашения, прежде чем вы сможете погасить Код.

После того, как код был погашен, он не может быть использован повторно.

4. Регистрация

i. Требования к счету

Только владельцы учетной записи CGP могут использовать Сервис.

ii. Обязанности

Вы несете ответственность за сохранение конфиденциальности имени пользователя и пароля вашей учетной записи.Вы несете ответственность за все действия, которые происходят под вашей учетной записью.

Если вам станет известно о любом несанкционированном использовании вашей учетной записи, вы должны немедленно уведомить нас.

5. Прекращение действия

i. Прекращение действия клиента

Если вы хотите прекратить действие своей учетной записи, свяжитесь с нашей службой поддержки клиентов по телефону 0800 1712 712.

ii. Прекращение действия CGP Books

Соглашение и доступ, предоставленный для использования Сервиса, автоматически прекращаются, если вы не соблюдаете какую-либо часть этого Соглашения.Прекращение действия Соглашения (каким бы то ни было образом) не влияет на возникшие права или обязательства любой из сторон.

iii. Прекращение обслуживания

Мы оставляем за собой право прекратить предоставление Услуги до истечения срока действия вашего доступа к вашим заголовкам. CGP должен предоставить возмещение за оставшийся период доступа или физическую копию заголовка (ов) в качестве замены.

6. Название

Вы обладаете только правом доступа к титулу на срок не более трех лет.

Содержание и авторские права на названия и другие права интеллектуальной собственности любого характера являются и остаются собственностью CGP или собственностью любых третьих лиц, которые могли лицензировать программное обеспечение или контент для CGP.

7. Поддержка

Пожалуйста, позвоните в отдел обслуживания клиентов по телефону 0800 1712 712, если у вас возникнут трудности или возникнут вопросы.

8. Заявление об ограничении ответственности

Вы несете ответственность за обеспечение надлежащей защиты ваших компьютерных сетей от вирусов и других вредоносных программ.Мы не несем ответственности за какие-либо эффекты вирусов или вредоносных программ, каким бы то ни было образом они попали в ваши системы.

Вы несете ответственность за то, чтобы перед использованием Сервиса вашими сотрудниками, агентами или студентами все такие стороны были уведомлены и согласны с условиями настоящего Соглашения.

Мы исключаем и прямо отказываемся от всех явных и подразумеваемых гарантий или условий, не указанных в настоящем Соглашении (включая, помимо прочего, потерю дохода, потерю или повреждение данных, прерывание бизнеса или потерю контрактов), поскольку такое исключение или отказ от ответственности разрешены. в соответствии с действующим законодательством.Это Соглашение не влияет на ваши законные права.

9. Ответственность

и. Наша ответственность перед вами за любые убытки не должна превышать сумму, которую вы первоначально заплатили за услугу.

ii. Ни при каких обстоятельствах мы не несем ответственности за любые косвенные или косвенные убытки или потерю дохода. В частности, мы не несем ответственности за какие-либо программы или данные, созданные или хранимые с помощью службы, а также за расходы на восстановление или замену таких программ или данных. Ничто в этом Соглашении не ограничивает ответственность за умышленное введение в заблуждение или нашу ответственность перед вами в случае смерти или телесных повреждений в результате нашей халатности или халатности наших сотрудников, агентов или субподрядчиков.

10. Третьи стороны

The pa

PPT — Презентация PowerPoint буклета по биологии, скачать бесплатно

  • Первый семестр Буклет по биологии 10 класс Advanced Unit4 Синтез ДНК и белка Имя: —————— ————————- Класс: ——————-

  • Уровень продвинутого уровня 10 4: Синтез ДНК и белка Ключевые слова ссылки Упражнения Чтение текста только для улучшения языка

  • Уровень продвинутого уровня 10 4: Синтез ДНК и белка Содержание

  • Уровень продвинутого уровня 10 Уровень 4: Синтез ДНК и белка Занятие 4 Стандарты синтеза ДНК и белков: 10A.11.1. Опишите двойную спиральную структуру и полуконсервативную репликацию ДНК, а также признайте важность пар оснований. يصف التركيب الحلزوني المزدوج لجزئ ال د ن والاستساخ الذاتي ويدرك أهمية تزاوج قواعد ا الجزئ. 10A.11.2 Опишите роль ДНК, мРНК и тРНК в синтезе белка и поймите, как последовательность оснований на ДНК контролирует структуру и функцию белка. يصف دور كلا من د ن ، ر ن الرسول ، ر ن الناقل في بنن البروتينات ، ويفهم كيف أن تتابع القواعد في جزئ د ن أ يتحكم في تركيب ووظيفة البروتين.10A.11.3 Знайте, что базовая последовательность ДНК формирует генетический код и передается от поколения к поколению 1

  • Уровень продвинутого уровня 4: ДНК и синтез белка Ключевые слова 2

  • Уровень продвинутого уровня 10 Уровень4: Синтез ДНК и белка Структура ДНК и РНК تركيب ال د ن & ال ر ن Генетический материал живых организмов представляет собой ДНК или РНК.ДНК — Дезоксирибонуклеиновая кислота РНК — Гены рибонуклеиновой кислоты: длины ДНК, которые кодируют определенные белки. • И ДНК, и РНК являются полинуклеотидами. • Они состоят из более мелких молекул, называемых нуклеотидами. • ДНК состоит из двух нитей полинуклеотидных: • РНК состоит из одной полинуклеотидной цепи: • تتكون المادة الوراثية في الكائنات الحية من الحمض النووي د ن أ أو ر ن ا • د ن أ: الحمض النووي منقوص الأكسجين • ر ن أ: الحمض النووي امل الأكسجين • الجينات: هي أجزاء من ال د ن وكل جين يعبرعن بروتين محد.• يعتبر الحمضين د ن ر ن من النيوكليوتيدات المتعددة. • يتكون لاهما من يئات صغيرة تدعى (نيوكليوتايد); • يتكون ال ر ن من يط واحد من النيوكليوتيدات المتعددة. Полинуклеотиды нуклеотидов дезоксирибонуклеиновой кислоты. Нить рибонуклеиновой кислоты Гены 3

  • Уровень 10 Advanced Unit4: ДНК и синтез белка Структура нуклеотида Нуклеотид состоит из 3 компонентов: 1- Пентозный сахар. Это 5-углеродный сахар. Ксирибоза в ДНК представляет собой дезо-сахар.Сахар в РНК — это рибоза. 2-АФосфатная группа Фосфатные группы важны, потому что они связывают сахар на одном нуклеотиде с фосфатом следующего нуклеотида с образованием полинуклеотида. • 3-АНитогенное основание • В ДНК четыре основания: • тимин (урацил в РНК) • аденин • цитозин • гуанин تتكون النيوكليوتيدة من 3 ا 1: 1 — سكر خماسي: يتكون من 5 رون من 5 رون النيوكليوتيدة من 3 اء: 1 — سكر ماسي: يتكون النيوكليوتيدة (رايبوز منقوص الأكسجين). أما في ال ر ن أ فيسمى السكر (رايبوز). 2- مجموعة فوسفات: تعتبر مجموعة الفوسفات مهمة لأنها تصل السكر الموجود على النيوكليوتيدة بالفوسفات الموجود على النيوكليوتيدة التالية لتكوين النيوكليوتيدات المتعددة.3- قاعدة نيتروجينية: توجد أربعة قواعد في د ن أ: ثايمين (يوراسيل في ر ن أ) أدينين سايتوسين جوانين Nitogenous основание цитозин Пентозы сахара урацил аденин гуанин тимин 4

  • 10 класс Расширенный Unit4: ДНК и синтез белка упражнения Вопрос 1 : Посмотрите на диаграмму ДНК и ответить на следующие вопросы: السؤال الأول: انظر إلى نموذج ال د ن أ المرفق, ثم أجب على الأسئلة التالية: • Круг нуклеотид — ضع دائرة على نيوكليوتيدة كاملة • Добавьте сахар и фосфат — حدد السكر والفوسفات • Пометьте основы, которые еще не промаркированы — حدد القواعد التي لم يتم تحديدها • Две стороны спирали ДНК удерживаются вместе ____ _______bond — يرتبط خيطين ال د ن ساعد بع ب количество of___________ и количество гуанина всегда равно сумме _____________ • — دائما تتساوى أعداد قواعد الأدنين مع أعداد قواعد ________ • كما تتساوى أعداد قواعد الجوانين مع أعداد قواعد _________ 5

  • 10 класса Advanced UNIT4: DNA & синтеза белок азотистых основания القواعد النيتروجينية Pyramidines البريميدينات аденин — гуанин — G пурины البيورينات тимин — Т цитозин — C урацил — U Base-PairingRule قانون ربط القواعد النيتروجينية: А всегда пары с TC всегда пары с G يرتبط الأدينين دائماً مع الثايمين يرتبط السايتوسين دائماً مع الجوانين http: // student.ccbcmd.edu/biotutorials/dna/dnareppr.html 6

  • Уровень 10 Advanced Unit4: ДНК и синтез белка Сахарные фосфатные связи (основа ДНК) друга фосфата на один нуклеотид и сахара на следующей нуклеотида с образованием полинуклеотид ترتبط النيوكليوتيدات مع بعضها البعض بواسطة ارتباط مجموعة الفوسفات من النيوكليوتيدة السابقة بالسكر الموجود في النيوكليوتيدة اللاحقة, لتكوين النيوكليوتيدات المتعددة.нуклеотидные основания слабо соединены посередине водородными связями. ترتبط القواعد الموجودة ي النيوكليوتيدات بالوسط مع بعضها البعض بواسطة روابط هيدروجينية ضعيفة. 7

  • Уровень 10 Advanced Unit4: ДНК и синтез белка Спаривание оснований ر ب القواعد النيتروجينية Азотистые основания сочетаются с другими основаниями. Например, основания одной цепи пары оснований ДНК с основаниями противоположной цепи ДНК. ترتبط القواعد النيتروجينية مع بعضها البعض في جزئ ال د ن أ, بحيث ترتبط القواعد الموجودة على أحد الخيطين مع القواعد المتممة لها على الخيط الآخر وفق قانون الربط السابق.8

  • Уровень продвинутого уровня 4: ДНК и синтез белка Упражнения • Вопрос 1: Заполните поле правильным ответом • Ответ: ملئ الفراغات التالية بالكلمات التالية. — ناك نوعان من الأحماض النووية هما ________________ و ___________ • 2. В 5 азотистые основания делятся на две группы: • пуринов, которые включают ___________________ и _______________ • Пиримидины которые являются ______________ _______________ и ________________ • 2- هناك 5 أنواع من القواعد النيتروجينية والتي تم تصنيفها إلى مجموعتين أساسيتين: • البيورينات: والتي تشمل _______________ _______________ و • والبيريميدينات: والتي تشمل _______________ و _______________ Вопрос 2: Выберите цвет для каждой части нуклеотида и залейте квадрат желаемым цветом.Раскрасьте деталь в тон. السؤال الثاني: لون المربع الموجود أمام كل جزء باللون الذي يعبر عنه في نموذج أسفل: Фосфат Пентозы Сахар Азот Базовый فوسفات سكر خماسي قاعدة نيتروجينية 9

  • 10 класс Расширенный Unit4: ДНК и синтез белка Вопрос 3 Заполните следующую таблицу для сравнения ДНК и РНК: السؤال الثالث: إملأ الجدول التالي للمقارنة بين ال د ن أ و ال ر ن أ: 10

  • 10 класс Расширенный Unit4: ДНК и синтез белка репликации ДНК نسخ ال د ن أ Это означает, что копирование ДНК.Это описывается как полуконсервативная репликация. Это означает, что молекула ДНК реплицируется и производит новую молекулу как из старой, так и из новой. Каждая дочерняя ДНК состоит из старой цепи и новой цепи. Репликация ДНК происходит непосредственно перед делением клетки. ويعني مضاعفة ال د ن أ ونسخه, ويتم فيه اصدار نسخة إضافية مع المحافظة على النسخة الأصلية, بمعنى أنه يتم نسخ جزئ ال د ن أ لإنتاج جزئ جديد مع البقاء على الجزئ الأصلي, وكل جزئ جديد من ال د ن أ يتكون من خيطين (شريطين ).Репликация полуконсервативно состоит из деления клеток. حلزون ال د ن الأصلي جزيئين ال د ن بعد عملية نسخ واحدة 11

  • Grade 10 Advanced Unit4: ДНК и синтез белков Meselوسالي и Stني.com jkimball.ma.ultranet / BiologyPages / M / Meselson_Stahl.html 12

  • Уровень продвинутого уровня 4: синтез ДНК и белка Упражнения Вопрос 1: со ссылкой на рисунок ниже ответьте на следующие вопросы: ب على الأسئلة التالية: (a) (b) (c) (d) • Репликация ДНК происходит непосредственно перед клеткой.Процесс создания копии ДНК описывается как __________________ • 2- تسمى العملية التي يتم فيها نسخ جزئ د ن أ بال ______________ • 3. Что из вышеперечисленного представляет: • 3- اختر من الأجزاء الأربعة السابقة ما يعبر عن • — ДНК родителей? ____________ • جزئ ال د ن أ الأصلي • — ДНК дочери? _____________ • ا ال د ن المنسوخ (الجديد) 13

  • Вопрос 2: Для каждой из трех приведенных ниже последовательностей ДНК запишите последовательность комплементарной цепи ДНК, которая образуется после репликации.السؤال الثاني: لكل شريط (أو خيط) من أشرطة ال د ن أ التالية, اكتب الشريط أو الخيط المتمم له بعد عملية النسخ молекула ДНК الجزئ الأول # 1: TACCGGATGCCAGATCAAATC комплементарной ДНК جزئ د ن أ المتمم # 1 ________________________________ молекула ДНК الجزئ الثاني # 2: TACGGGGGCGTAACCACAACT Комплементарная ДНК د ن أ المتمم # 2 _________________________________ Молекула ДНК الجزئ الثالث # 3: TACCTGTTAAGCTACAAAATT Комплементарная ДНК جزئ د ن المتمم # 3 _________________________________ Класс 10 Продвинутый код 4: Синтез ДНК и белка 9004

    Синтез ДНК и белка 149

    الشفرة الوراثية триплеты генетического кода codon Это информация, необходимая для создания определенного белка из молекулы ДНК.Он состоит из трех базовых троек). последовательность оснований или триплетов называется кодоном. ATC CTG TAG Каждый кодон соответствует определенной аминокислоте. Многие аминокислоты превращают пептид в белок. Это известно как пептид синтеза белка. وكل شفرة وراثية تعبر عن حمض أميني واحد, ومجموعة الأحماض تتحد مع بعض لتكوين الببتيد ليعطي البروتين .وهو مايسمى ببناء البروتين 15

  • 10 класс Расширенный Unit4: ДНК и синтез белка БЕЛКА ДНК мРНК ДНК, синтез белка, мРНК и тРНК د ن Синтез белка Это образование белка из молекулы ДНК с использованием генетического кода путем транскрипции и трансляции.Веб-сайт: د ن ر ن الرسول بروتين формирование транскрипции мРНК трансляция тРНК www.biostudio.com/demo_freeman_protein_synthesis.htm 16

  • Grade 10 Advanced Unit4: ДНК и синтез белков к РНК (РНК-мессенджер) в ядре согласно спариванию оснований (AU) и (GC).ДНК TAGGACATCCGC мРНК UAGGACAUCCGC Транскрипция произошла потому, что мРНК может покинуть ядро, а ДНК — нет. تحدث عملية النسخ لأن ر ن الرسول يستطيع مغادرة النواة ، بينما د ن أ لا يستطيع. • Этапы транскрипции • 1. Раскрутите один ген в ДНК. • 2. сопоставьте основания РНК с одной стороной ДНК (A связывает T), (C связывает G) • 3. мРНК отделяется от ДНК. • 4. мРНК выходит из ядрышка в цитоплазму. • Генетический код = Кодон = тройной код, они кодируют конкретную аминокислоту.• وات عملية النسخ: • 1- ينفك أو ينحل جين واحد من جزئ ال د ن أ. • 2-يتم ربط واعد ال ر ن ي نانب واحد من ال د ن أ (الأدينين مع الثايمين و والسايتوسين انين انين انين). • 3- ينفصل ر ن الرسول من ال د ن أ. • 4- يترك ر ن الرسول النوية ويخرج إلى السيتوبلازم. • الشفرة الوراثية = الكودون = الشفرة الثلاثية • وكل شفرة خاصة بتكوين حمض أميني محدد. 17

  • Уровень 10 Advanced Unit4: ДНК и синтез белка 2- Трансляция (процесс создания белка) ثانياً: عملية الترجمة (عملية صناعة البروتين) — это процесс использования кодированной последовательности аминокислот для получения инструкций полиРНК тРНК — это короткая РНК, один кодон которой соответствует мРНК, называемой антикодоном, а аминокислота соответствует антикодону.В рибосоме произошел синтез белка. ي عملية استخدام الشفرات الموجودة في ال ر ن الرسول لتكوين تابعات من الأحماض المينية نؤايد دتتلتلتنجايد دتتلتلتنؤايد دتابعات الحماض المينية نؤاد دتلتلتنؤايد دتلتلتنؤايد دتتلتنايد دتتلتلبياد دتتلتلبياد دتيتبياد. ويعتبر ال ر ن أ الناقل أقصر ر ن أ, فهو يتكون من كودون واحد متصل بال ر ن أ الرسول ويسمى مضاد الكودون, ويتصل الحمض الأميني بمضاد الكودون. كما تحدث عملية بناء البروتين في الرايبوسوم. м РНК UAGGACAUCCGC т РНК АУК ЗГП UAG GCG Пептиды Amb Асп Lleu Arg (аминокислоты) различные кодоны означают различные аминокислоты (الأحماض الأمينية): اختلاف الكودونات يعني اختلاف الأحماض الأمينية تتابع القواعد على ر ن أ الرسول تتابع القواعد على ر ن أ الناقل الأحماض المينية الناتجة تبعاً للقواعد السابقة 18

  • Уровень 10 Advanced Unit4: Синтез ДНК и белка Этапы перевода 1.мРНК прикрепляется к рибосоме 2. РНК переноса (тРНК) приносит аминокислоты для создания копии пептида. 3. Антикодон (3 основания на тРНК) совпадает с Кодоном на мРНК. 4. Белок (цепочка аминокислот) отделяется от рибосомы и начинает работать. Разные кодоны означают разные аминокислоты. وات الترجمة: 1- يرتبط ال ر ن أ الرسول بالرايبوسوم. 2- يقوم ر ن الناقل بإحضار الأحماض الأمينية لبناء نسخة من الببتيد (بروتين). 3- مضاد الكودون (3 واعد على ال ن الناقل) تتصل بالكودون على ال ر ن الرسول.4- ينفصل البروتين (سلسلة من الأحماض الأمينية) من الرايبوسوم ويذهب لأداء وظيفته. الكودونات المختلفة تعني أحماض أمينية مختلفة. рибосома 19

  • Уровень 10 Advanced Unit4: ДНК и синтез белка Вопрос 1: Для каждой из тех же последовательностей ДНК, представленных ниже, запишите последовательность кодонов информационной РНК, которая синтезируется во время транскрипции. Обязательно разделите кодоны на тройки. السؤال الاول: اكتب الكودونات التي ستتكون على ال ر ن أ الرسول وفقا للتابعات الموجودة على ال د ن أ والتي ستبني البروتينات أثناء عملية النسخ (تأكد أن كل كودون عبارة عن 3 قواعد فقط): Молекула ДНК # 1: TACCGGATGCCAGATCAAATC мРНК # 1 _____________________________________________________ ДНК молекула № 2: TACGGGGGCGTAACCACAACT мРНК № 2 ___________________________________________________ Молекула ДНК № 3: TACCTGTTAAGCTACAAAATT мРНК № 3 __________________________________________________ Упражнения 20

  • Уровень 10 Advanced Unit4: последовательность ДНК и синтеза белка записана для каждой последовательности кодовых последовательностей вашей мНК: B): Соответствующие антикодоны тРНК.ب): اكتب تتابع القواعد النيتروجينية لمضاد الكودون على ال ر ن أ الناقل تبعا للكودونات الموجودة على ال ر ن أ الرسول التي تم كتابتها في الخطوة السابقة: антикодоны для мРНКа # 1: ___________________________________________ антикодонов для мРНКа # 2: ___________________________________________ антикодонов для мРНКа # 3 : ___________________________________________ Вопрос 2: Используя приведенную ниже таблицу, напишите аминокислотную последовательность, кодируемую каждой мРНК. Полипептид № 1: __________________________________________________ Полипептид № 2: __________________________________________________ Полипептид № 3: __________________________________________________ 21

  • Уровень 10 Advanced Unit 4: ДНК и синтез белка Вопрос 3: Посмотрите на диаграмму ниже и ответьте на следующие вопросы: م أجب على الأسئلة التالية: Эта стадия называется تسمى هذه المرحلة ب ________ Эта стадия называется ____________ تسمى هذه المرحلة ب ______________ a) Обозначьте следующее: белок, мРНК, ДНК (транскрипция ДНК), ДНК _________ в то время как перевод происходит в клетке _____________ أ) ضع البيانات التالية على الرسمة: بروتين — ر ن أ الرسول — رايبوسوم _ د ن أ ب) تحدث عملية نسخ ال د ن أ في ______________ الخلية, بينما تحدث عملية الترجمة في _________________.22

  • Уровень продвинутого уровня 10: синтез ДНК и белка Вопрос 4: Для каждой из приведенных ниже последовательностей ДНК запишите последовательность кодонов информационной РНК, которая синтезируется во время транскрипции. Обязательно разделите кодоны на тройки. السؤال الرابع: اكتب القواعد النيتروجينية (الكودونات) على ال ر ن أ الرسول والتي سيتم تكوينها أثناء عملية النسخ, لكل سلسلة من سلاسل ال د ن أ التالية: (تأكد من كتابة القواعد على شكل شفرات ثلاثية): Молекула ДНК # 1: мРНК TACCGGATGCCAGATCAAATC # 1 ____________________________________________ молекула ДНК # 2: мРНК TACGGGGGCGTAACCACAACT # 2 ________________________________________________ молекула ДНК # 3: TACCTGTTAAGCTACAAAATT мРНК # 3 _______________________________________________ جزئ ال د ن أ الأول: الكودونات على ال ر ن أ الرسول للجزئ الأول جزئ ال د ن أ الثاني: الكودونات على ال ر ن أ «» • • • • • • • • • • ПРОЧИТАЙТЕ вопрос, а затем ответьте на вопрос «ПРОЧИТАННЫЙ», 900 14 90 7 21 9 000, синтез 900 4 13, затем прочтите 10 и продвинутый синтез текста (текст ACT2 900 4 13) Прочтите 10 минут и продвинутый уровень синтеза. вопросов.السؤال الخامس: رأ النص التالي ثم أجب على الأسئلة التالية: Жизнь определяется геномами. Каждый организм, включая человека, имеет геном, содержащий всю биологическую информацию, необходимую для создания и поддержания живого образца этого организма. Биологическая информация, содержащаяся в геноме, закодирована в его ДНК и разделена на дискретные единицы, называемые генами. 3- Напишите резюме для приведенного выше текста. 3 — ل النص السابق بأسلوبك ……………………………………………………………………………………………………………………… …………………………………………………………………………………………………………………………………… …… 24

  • Уровень 10 Advanced Unit4: ДНК и синтез белков المشروع الير • Ваш последний проект — создать трехмерную модель ДНК.• المشروع النهائي عبارة عن تصميم نموذج لل د ن لاثي الأبعاد Заключительный проект • Вы можете работать в группе из 3-4 студентов • в группе (я хочу видеть, как работает группа • а не отдельная работа) • Бесплатная энциклопедия, энциклопедия это • очень полезный сайт для начала и получения • информации (нуклеотид, ДНК, аденин, • тимин, цитозин, гуанин, • комплементарное спаривание оснований تستطيعون العمل عل ل مجموعا مكونة مني مموعا مكونة مني مموعا مكونة منيييات مكونة منييي لاب (ميرلعية) يعتبر موقع مفيد لأخذ معلومات متعلقة بالموضوع وتستطيعون الاستعانة بهذه المفردات (نيوكليوتيد, د ن أ, أدينين, ثايمين, سايتوسين, جوانين, قانون ربط القواعد).Срок выполнения проекта ———ر موعد لتسليم المشروع ————— 25

  • Уровень 10 Продвинутый Модуль 4: Синтез ДНК и белка Оценочный критерий Для вашей модели ДНК غير دقيقة أو غير موجودة بعض البيانات موجودة وصحيحة معظم البيانات موجودة وصحيحة جميع البيانات موجودة وصحيحة بعض من القواعد النيتروجينية مرتبطة بشكل صحيح ودقيق جميع القواعد النيتروجينية مرتبطة بشكل صحيح ودقيق معظم القواعد النيتروجينية مرتبطة بشكل صحيح ودقيق قليل جدا من القواعد النيتروجينية مرتبطة بشكل صحيح ودقيق участие в или активно слушал обсуждение в классе.Несколько обращал внимание при построении модели. Играл активную роль в обсуждении занятия в классе. Уделял внимание при построении модели. Немного послушал обсуждение. Были проблемы с вниманием во время изготовления модели. Никакого внимания и участия в обсуждении. Не обращал внимания при постройке модели. الاستماع للمناقشة بإهتمام و إظهار بعض الاهتمام أثناء بناء النموذج. الاستماع للمناقشة بإهتمام وفاعلية ، و ار الاهتمام الشديد أثناء بناء النموذج.لم يظهروا أي اهتمام و مشاركة أثناء المناقشة وبناء النموذج الاستماع للمناقشة الى حد ما وانمام دلبيبيبيما. 26

  • Уровень 10 Advanced Unit4: ДНК и синтез белка Ссылки: Advanced Biology для вас Интернет 27

  • Контрольные работы по биологии 10 класса Бесплатная загрузка для Windows

    Бесплатные материалы для тестов по биологии 10 класса

    в Software Informer

    Это программа, которая содержит информацию, относящуюся к изучению биологии.

    G10 Science Biology — это программа … относящаяся к изучению биологии, которая … серия тестов, которые учащиеся

    CaseWare International 1,262 Коммерческий

    CaseWare Working Papers — это очень гибкое программное обеспечение для взаимодействия.

    Больше бесплатных контрольных работ по биологии для 10-го класса

    Бесплатные контрольные работы по биологии 10-го класса во введении

    Леки и Леки 6 Коммерческий

    Этот продукт обеспечивает визуальный подход к редактированию и помогает студентам.

    Лучшие оценки 2 Условно-бесплатное ПО

    Он разработан для учеников начальной школы 1 от 7 лет, изучающих английский язык и математику.

    Практический тест бесплатно 11 Бесплатное ПО

    Готовит вас к сдаче теста MCAT, предлагая 60 вопросов.

    Лучшие оценки 3 Условно-бесплатное ПО

    Контрольные работы начальной школы 3 предназначены для учащихся начальной школы 3 в возрасте 9 лет.

    6 Программное обеспечение Hirtle 81 год Условно-бесплатное ПО

    Создавайте экранные, бумажные или Интернет-тесты на основе случайно выбранных вопросов.

    Программное обеспечение Smart Kids 25 Коммерческий

    Используйте свои навыки решения проблем 6-го класса, спасая землю в этой игре.

    Программное обеспечение EleMaths 2 Условно-бесплатное ПО

    Теперь вы можете подготовить и распечатать рабочие листы по алгебре и преалгебре или контрольные работы.

    CertMagic Условно-бесплатное ПО

    E20-830 Экзамен включает учебные материалы, техническое обучение и контрольные работы.

    45 ООО «Кута Софтвер» 76 Условно-бесплатное ПО

    Создавайте задания и контрольные работы по математике из типичных тем Precalculus.

    1 Kyocera 16 Проприетарный

    Распечатайте, оцените и проанализируйте результаты теста с множественным выбором.

    Дополнительные заголовки, содержащие бесплатные контрольные работы по биологии 10 класса

    1 Эдурите 9 Коммерческий

    С помощью ICSE Class 9 Biology ваш ребенок может узнать много интересного о биологии.

    9 Обучающая компания 266 Коммерческий

    Reader Rabbit Grade 2.0.10.0 — обучающая игра для 2-го. классные дети.

    1 ATI Research, Inc. 9 Бесплатное ПО

    ATI RADEON 9700 Bacteria Screen Saver Заставка для любителей биологии.

    40 Lynnon Corporation 596 Условно-бесплатное ПО

    DNAMAN — это универсальный программный пакет для приложений молекулярной биологии.

    5 XiaLab 335 Бесплатное ПО

    Это приложение для обширного анализа данных в области молекулярной биологии и эволюции.

    PT.Центринова Солуси Эдукаси 4

    PT. Центринова Солуси Эдукаси 5

    PT. Центринова Солуси Эдукаси 5

    NEAEA Оценка 10 Результат 2020 www.neaea.gov.et 10 класс 2020

    NEAEA, результат 10-го класса 2020 г. : www.neaea.gov.et 10-й класс 2020 г.: проверьте результат национального экзамена 10-го класса в Эфиопии за 2020 г. Учащиеся могут проверить результаты на сайте app.neaea.gov.et. Из-за пандемии сдача 10-го экзамена откладывается.

    Национальное агентство по оценке и экзаменам в образовании (NEAEA), Эфиопия скоро опубликует свой первый результат национального экзамена 2020 (EC 2011). Учащимся из Эфиопии следует проверить Результат 10 класса 2020 на нашем веб-сайте www.neaeagovet.com.

    Раньше учащиеся использовали официальный сайт www.nae.gov.et для проверки результатов экзамена за 10 класс 2020 . Однако теперь neaea gov et поможет нам проверять результат национального экзамена 10 баллов 2010 EC.

    NEAEA Оценка 10 Результат 2020

    • В соответствии с политикой Эфиопского образования и профессиональной подготовки, региональный экзамен сдается в классе 8 для завершения начального образования и поступления в среднюю школу.
    • Первый национальный экзамен , Эфиопский экзамен на аттестат об общем среднем образовании (EGSECE) , сдается в 10 классе . Национальное агентство оценки и экзаменов в области образования (NEAEA) выдало экзамен на аттестат зрелости (EGSLCE) ученикам, окончившим 10 класс.
    • NEAEA отвечает за публикацию результатов экзамена для 10-го класса для студентов, сдавших экзамены в 2017-2020 учебном году.Студенты также могут получить доступ к своим личным результатам (« NEAEA Grade 10 exam result 2010 EC ») на официальном веб-сайте Агентства по следующей ссылке: www.neaea.gov.et/Home/Student .

    Дата окончания экзамена 10 класс 2020

    Старые даты: NEA Эфиопии (www.nae.gov.et) опубликовало результат 10 баллов 6 сентября , 2017. Однако в 2016 году NEAEA опубликовал Эфиопский результат 10 баллов 27 августа , 2016.

    Ежегодно результат объявляется либо в августе, либо в первую неделю сентября. В прошлом году экзамен сдали более миллиона студентов по всей стране, из которых 47,7 процента — девушки.

    NEAEA Оценка 10 Результат 2020

    Ожидаемая дата выпуска: Скоро
    Присоединяйтесь к нашей странице в Facebook для получения дополнительных обновлений.

    Как проверить эфиопский класс 10 Результат 2020:

    Национальное экзаменационное агентство (NEA) позволяет студентам получить доступ к Ethiopia Student Result онлайн.В результате результат экзамена за 10 класс также можно проверить онлайн.

    • Включите ноутбук или мобильный телефон и подключитесь к Интернету.
    • Откройте веб-браузер и введите www.neaea.gov.et
    • Проверьте главное меню и нажмите Student Result .
    • Теперь выберите сорт 10.
    • Введите свой «Регистрационный номер»
    • Наконец, нажмите GO.

    Пример результата 10-й степени в Интернете (app.neaea.gov.et)

    Имя Hipes ****
    Пол Мужской
    Статус Допускается

    Субъекты

    Сорта

    Афаан Оромоо A
    Амхарский A
    Биология A
    Химия B
    Гражданские B
    Английский D
    География A
    История С
    Математика D
    Физика A

    Результат экзамена за 10 класс 2020 по SMS

    Если у вас нет подключения к Интернету, не беспокойтесь, NEA упростил студентам проверку результатов 10-го экзамена в Эфиопии.